Incidental Mutation 'R4875:Ndufv1'
ID376753
Institutional Source Beutler Lab
Gene Symbol Ndufv1
Ensembl Gene ENSMUSG00000037916
Gene NameNADH dehydrogenase (ubiquinone) flavoprotein 1
Synonyms24 kDa (FP)
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.908) question?
Stock #R4875 (G1)
Quality Score208
Status Validated
Chromosome19
Chromosomal Location4007497-4012806 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 4012653 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042497] [ENSMUST00000128787] [ENSMUST00000129706] [ENSMUST00000133474] [ENSMUST00000134479] [ENSMUST00000136921]
Predicted Effect probably benign
Transcript: ENSMUST00000042497
SMART Domains Protein: ENSMUSP00000042967
Gene: ENSMUSG00000037916

DomainStartEndE-ValueType
Pfam:Complex1_51K 80 252 2.4e-52 PFAM
Pfam:SLBB 275 327 5.1e-10 PFAM
NADH_4Fe-4S 364 409 1.05e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128787
SMART Domains Protein: ENSMUSP00000123069
Gene: ENSMUSG00000037916

DomainStartEndE-ValueType
Pfam:Complex1_51K 71 243 1.6e-52 PFAM
Pfam:SLBB 266 318 8.6e-10 PFAM
NADH_4Fe-4S 355 400 1.05e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129706
SMART Domains Protein: ENSMUSP00000115653
Gene: ENSMUSG00000037916

DomainStartEndE-ValueType
Pfam:Complex1_51K 80 115 1.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132747
Predicted Effect probably benign
Transcript: ENSMUST00000133474
SMART Domains Protein: ENSMUSP00000120223
Gene: ENSMUSG00000037916

DomainStartEndE-ValueType
Pfam:Complex1_51K 1 146 3.3e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134049
Predicted Effect probably benign
Transcript: ENSMUST00000134479
SMART Domains Protein: ENSMUSP00000121915
Gene: ENSMUSG00000037916

DomainStartEndE-ValueType
Pfam:Complex1_51K 1 173 3.6e-53 PFAM
Pfam:SLBB 196 248 5.2e-11 PFAM
NADH_4Fe-4S 285 330 1.05e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000136921
SMART Domains Protein: ENSMUSP00000123680
Gene: ENSMUSG00000037916

DomainStartEndE-ValueType
Pfam:Complex1_51K 1 114 6.7e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150852
Meta Mutation Damage Score 0.632 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: This gene encodes a subunit of the NADH-ubiquinone oxidoreductase (complex I) enzyme, which is a large, multimeric protein. It is the first enzyme complex in the mitochondrial electron transport chain and catalyzes the transfer of electrons from NADH to the electron acceptor ubiquinone. The proton gradient created by electron transfer drives the conversion of ADP to ATP. This gene is a core subunit and is conserved in prokaryotes and eukaryotes. The human ortholog of this protein has been characterized. It has consensus motifs for NADH, flavin mononucleotide, and iron-sulfur binding sites and participates in the oxidation of NADH as part of the dehydrogenase module of complex I. In humans, deficiencies in complex I are associated with myopathies, encephalomyopathies, and neurodegenerative disorders. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak1 A T 2: 32,631,177 E119D probably benign Het
Alox5 A T 6: 116,413,850 probably null Het
Atad5 T C 11: 80,120,689 V1294A probably damaging Het
BB019430 A G 10: 58,704,043 noncoding transcript Het
Bbs9 T C 9: 22,578,715 F261L probably benign Het
Catsperb A T 12: 101,587,985 N646I possibly damaging Het
Ccdc112 A G 18: 46,296,289 I114T probably damaging Het
Cecr2 T C 6: 120,750,916 L340P probably damaging Het
Ces2e T A 8: 104,927,185 V85E probably damaging Het
Cnpy2 C A 10: 128,326,095 T79K probably damaging Het
Cntn4 G A 6: 106,437,913 R135H possibly damaging Het
Cpne8 T A 15: 90,648,568 probably benign Het
Ctso C T 3: 81,942,381 probably benign Het
Cyp3a16 C A 5: 145,452,849 M235I probably benign Het
Dll3 A G 7: 28,296,435 C314R probably damaging Het
Dnah7c A G 1: 46,688,925 N2928D probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dqx1 C A 6: 83,061,012 D460E probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ehbp1 A G 11: 22,101,164 C438R probably damaging Het
Ehd3 T G 17: 73,805,304 V21G probably damaging Het
Ero1lb G A 13: 12,604,436 V440I probably damaging Het
Fpgt G A 3: 155,087,913 A159V probably damaging Het
Gcn1l1 T C 5: 115,576,170 L123P possibly damaging Het
Gm14496 A T 2: 181,997,433 R439W probably damaging Het
Gm20767 T C 13: 120,154,670 V15A probably damaging Het
Gm4353 G C 7: 116,084,413 P49R probably damaging Het
Gsdmc2 C T 15: 63,828,252 A224T probably benign Het
Helz T A 11: 107,637,734 probably benign Het
Hnf1a T C 5: 114,970,673 T58A probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcns1 T C 2: 164,168,101 Y246C probably damaging Het
Kif26b A G 1: 178,915,327 E549G probably benign Het
Krt9 T C 11: 100,190,037 I330V probably benign Het
Lair1 A T 7: 4,029,034 S25T probably benign Het
Lhx4 T C 1: 155,705,267 T171A possibly damaging Het
Luzp2 A G 7: 55,167,248 I149V possibly damaging Het
Mcoln1 T A 8: 3,507,422 S143T probably benign Het
Mcph1 A G 8: 18,625,558 probably null Het
Mgat5 G A 1: 127,469,249 V578M probably damaging Het
Mis18bp1 G A 12: 65,161,435 T168M probably benign Het
Mospd4 G T 18: 46,465,737 noncoding transcript Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Myom1 T C 17: 71,072,119 V626A probably damaging Het
Nat6 C T 9: 107,583,619 R238C probably damaging Het
Ncam1 T C 9: 49,507,621 probably benign Het
Ncor1 AGCTGCTGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTGCTGCTG 11: 62,433,611 probably benign Het
Nlrp2 A T 7: 5,298,859 F211L probably benign Het
Olfr1368 T A 13: 21,142,280 Y259F probably damaging Het
Olfr1495 T A 19: 13,768,762 M140K probably damaging Het
Olfr517 A T 7: 108,868,786 F123I probably damaging Het
Osbpl11 G A 16: 33,234,493 V649I probably benign Het
Pax8 T A 2: 24,441,640 M144L probably benign Het
Pcnt T C 10: 76,369,854 T2555A probably benign Het
Plat T A 8: 22,768,450 I23K probably benign Het
Plpp2 G A 10: 79,530,929 T51M probably damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Prl7c1 T C 13: 27,773,759 M233V probably benign Het
Prox1 A C 1: 190,162,122 F42C probably damaging Het
Pwwp2b A T 7: 139,256,062 Q473L possibly damaging Het
Rims4 A T 2: 163,865,523 N127K probably null Het
Scn1a T C 2: 66,328,476 T367A possibly damaging Het
Slc23a2 A G 2: 132,056,880 I579T possibly damaging Het
Sp9 T C 2: 73,273,618 V172A possibly damaging Het
Spta1 T A 1: 174,175,830 L109Q probably damaging Het
Strap ACCTGCCCTCCT ACCT 6: 137,749,318 probably benign Het
Synj2 A T 17: 5,988,068 probably benign Het
Tgif2-ps2 A G 17: 40,115,383 noncoding transcript Het
Tnrc18 A T 5: 142,765,177 M1216K unknown Het
Tpst2 T A 5: 112,309,821 Y69* probably null Het
Tpx2 C A 2: 152,893,615 A721E probably benign Het
Trmt1l A G 1: 151,455,004 T591A probably benign Het
Tuba8 T A 6: 121,226,083 probably benign Het
Ubiad1 T C 4: 148,444,099 T118A possibly damaging Het
Unc13c T C 9: 73,517,284 T2017A probably damaging Het
Vmn1r59 G T 7: 5,454,109 N217K probably benign Het
Vmn2r87 T C 10: 130,472,498 I624V probably damaging Het
Wdr4 A G 17: 31,499,155 V315A probably benign Het
Xpo7 T C 14: 70,676,816 probably null Het
Zfp827 T A 8: 79,060,774 W190R probably damaging Het
Zfp971 A G 2: 178,033,147 T180A probably benign Het
Other mutations in Ndufv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01861:Ndufv1 APN 19 4008803 missense probably benign 0.03
IGL02376:Ndufv1 APN 19 4007823 unclassified probably null
R1929:Ndufv1 UTSW 19 4008347 missense probably benign 0.11
R2270:Ndufv1 UTSW 19 4008347 missense probably benign 0.11
R2271:Ndufv1 UTSW 19 4008347 missense probably benign 0.11
R3917:Ndufv1 UTSW 19 4010002 missense probably damaging 1.00
R4844:Ndufv1 UTSW 19 4012574 missense probably benign 0.00
R5188:Ndufv1 UTSW 19 4009988 missense probably damaging 1.00
R5853:Ndufv1 UTSW 19 4008811 splice site probably null
R6614:Ndufv1 UTSW 19 4008749 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- ACATCGTCAGCCTGGAGTTG -3'
(R):5'- AGAGTAAATTTCCGGTCTCTGTG -3'

Sequencing Primer
(F):5'- GGGACCGTTAGTTTTTATCCAGACC -3'
(R):5'- TGCCCGCGCACCTTTAG -3'
Posted On2016-03-17