Incidental Mutation 'R4873:Dnase1l1'
ID 376839
Institutional Source Beutler Lab
Gene Symbol Dnase1l1
Ensembl Gene ENSMUSG00000019088
Gene Name deoxyribonuclease 1-like 1
Synonyms 2310005K03Rik, G4.8, Dnase1ll, Dnl1ll
MMRRC Submission 042483-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R4873 (G1)
Quality Score 222
Status Validated
Chromosome X
Chromosomal Location 73316823-73325939 bp(-) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 73320644 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008826] [ENSMUST00000019232] [ENSMUST00000074085] [ENSMUST00000075821] [ENSMUST00000114189] [ENSMUST00000119361] [ENSMUST00000135690] [ENSMUST00000151702]
AlphaFold Q9D7J6
Predicted Effect probably benign
Transcript: ENSMUST00000008826
SMART Domains Protein: ENSMUSP00000008826
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 167 1.1e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000019232
SMART Domains Protein: ENSMUSP00000019232
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
DNaseIc 21 289 3.93e-149 SMART
low complexity region 301 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074085
SMART Domains Protein: ENSMUSP00000082055
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 167 1.1e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000075821
SMART Domains Protein: ENSMUSP00000075218
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
DNaseIc 21 289 3.93e-149 SMART
low complexity region 301 313 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083047
Predicted Effect probably null
Transcript: ENSMUST00000114189
SMART Domains Protein: ENSMUSP00000109827
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
Blast:DNaseIc 21 70 5e-22 BLAST
SCOP:d2dnja_ 39 79 2e-4 SMART
low complexity region 91 103 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119361
SMART Domains Protein: ENSMUSP00000113515
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
Blast:DNaseIc 21 64 2e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125775
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142142
Predicted Effect probably benign
Transcript: ENSMUST00000135690
SMART Domains Protein: ENSMUSP00000119500
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 150 1.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149171
Predicted Effect probably benign
Transcript: ENSMUST00000151702
SMART Domains Protein: ENSMUSP00000115919
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 167 1.5e-34 PFAM
Meta Mutation Damage Score 0.9711 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deoxyribonuclease protein that shows high sequence similarity to DNase I. The encoded protein is localized to the endoplasmic reticulum and modified by N-linked glycosylation. Alternate transcriptional splice variants encoding the same protein have been observed. [provided by RefSeq, Jan 2015]
PHENOTYPE: Female mice homozygous for an inactivating mutation of this gene exhibit poor motor coordination on the rotarod even on days 4 and 5 of a 5-day test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak1 A T 2: 32,521,189 (GRCm39) E119D probably benign Het
Alox5 A T 6: 116,390,811 (GRCm39) probably null Het
Atad5 T C 11: 80,011,515 (GRCm39) V1294A probably damaging Het
BB019430 A G 10: 58,539,865 (GRCm39) noncoding transcript Het
Bbs9 T C 9: 22,490,011 (GRCm39) F261L probably benign Het
Catsperb A T 12: 101,554,244 (GRCm39) N646I possibly damaging Het
Ccdc112 A G 18: 46,429,356 (GRCm39) I114T probably damaging Het
Cecr2 T C 6: 120,727,877 (GRCm39) L340P probably damaging Het
Ces2e T A 8: 105,653,817 (GRCm39) V85E probably damaging Het
Cnpy2 C A 10: 128,161,964 (GRCm39) T79K probably damaging Het
Cntn4 G A 6: 106,414,874 (GRCm39) R135H possibly damaging Het
Cyp3a16 C A 5: 145,389,659 (GRCm39) M235I probably benign Het
Dll3 A G 7: 27,995,860 (GRCm39) C314R probably damaging Het
Dnah7c A G 1: 46,728,085 (GRCm39) N2928D probably benign Het
Dqx1 C A 6: 83,037,993 (GRCm39) D460E probably benign Het
Dync1h1 C A 12: 110,624,560 (GRCm39) T3700N probably damaging Het
Ehbp1 A G 11: 22,051,164 (GRCm39) C438R probably damaging Het
Ehd3 T G 17: 74,112,299 (GRCm39) V21G probably damaging Het
Ero1b G A 13: 12,619,325 (GRCm39) V440I probably damaging Het
Fpgt G A 3: 154,793,550 (GRCm39) A159V probably damaging Het
Gcn1 T C 5: 115,714,229 (GRCm39) L123P possibly damaging Het
Gm14496 A T 2: 181,639,226 (GRCm39) R439W probably damaging Het
Gm4353 G C 7: 115,683,648 (GRCm39) P49R probably damaging Het
Gsdmc2 C T 15: 63,700,101 (GRCm39) A224T probably benign Het
Hnf1a T C 5: 115,108,732 (GRCm39) T58A probably benign Het
Igkv4-80 A C 6: 68,993,649 (GRCm39) S81A probably benign Het
Kcns1 T C 2: 164,010,021 (GRCm39) Y246C probably damaging Het
Kif26b A G 1: 178,742,892 (GRCm39) E549G probably benign Het
Krt9 T C 11: 100,080,863 (GRCm39) I330V probably benign Het
Lair1 A T 7: 4,032,033 (GRCm39) S25T probably benign Het
Lhx4 T C 1: 155,581,013 (GRCm39) T171A possibly damaging Het
Luzp2 A G 7: 54,816,996 (GRCm39) I149V possibly damaging Het
Mcoln1 T A 8: 3,557,422 (GRCm39) S143T probably benign Het
Mcph1 A G 8: 18,675,574 (GRCm39) probably null Het
Mgat5 G A 1: 127,396,986 (GRCm39) V578M probably damaging Het
Mis18bp1 G A 12: 65,208,209 (GRCm39) T168M probably benign Het
Mroh2a G T 1: 88,182,657 (GRCm39) R1195L possibly damaging Het
Myom1 T C 17: 71,379,114 (GRCm39) V626A probably damaging Het
Naa80 C T 9: 107,460,818 (GRCm39) R238C probably damaging Het
Ncam1 T C 9: 49,418,921 (GRCm39) probably benign Het
Nlrp2 A T 7: 5,301,858 (GRCm39) F211L probably benign Het
Or10a49 A T 7: 108,467,993 (GRCm39) F123I probably damaging Het
Or10q12 T A 19: 13,746,126 (GRCm39) M140K probably damaging Het
Or2ad1 T A 13: 21,326,450 (GRCm39) Y259F probably damaging Het
Osbpl11 G A 16: 33,054,863 (GRCm39) V649I probably benign Het
Oscar A T 7: 3,619,016 (GRCm39) probably null Het
Pax8 T A 2: 24,331,652 (GRCm39) M144L probably benign Het
Pcnt T C 10: 76,205,688 (GRCm39) T2555A probably benign Het
Plat T A 8: 23,258,466 (GRCm39) I23K probably benign Het
Plpp2 G A 10: 79,366,763 (GRCm39) T51M probably damaging Het
Pnkp C T 7: 44,511,827 (GRCm39) S113L probably damaging Het
Prl7c1 T C 13: 27,957,742 (GRCm39) M233V probably benign Het
Prox1 A C 1: 189,894,319 (GRCm39) F42C probably damaging Het
Pwwp2b A T 7: 138,835,978 (GRCm39) Q473L possibly damaging Het
Rims4 A T 2: 163,707,443 (GRCm39) N127K probably null Het
Scn1a T C 2: 66,158,820 (GRCm39) T367A possibly damaging Het
Slc23a2 A G 2: 131,898,800 (GRCm39) I579T possibly damaging Het
Sp9 T C 2: 73,103,962 (GRCm39) V172A possibly damaging Het
Spta1 T A 1: 174,003,396 (GRCm39) L109Q probably damaging Het
Synj2 A T 17: 6,038,343 (GRCm39) probably benign Het
Tcstv2c T C 13: 120,616,206 (GRCm39) V15A probably damaging Het
Tnrc18 A T 5: 142,750,932 (GRCm39) M1216K unknown Het
Tpst2 T A 5: 112,457,687 (GRCm39) Y69* probably null Het
Tpx2 C A 2: 152,735,535 (GRCm39) A721E probably benign Het
Trmt1l A G 1: 151,330,755 (GRCm39) T591A probably benign Het
Tubgcp4 T A 2: 121,015,330 (GRCm39) probably benign Het
Ubiad1 T C 4: 148,528,556 (GRCm39) T118A possibly damaging Het
Unc13c T C 9: 73,424,566 (GRCm39) T2017A probably damaging Het
Vmn1r59 G T 7: 5,457,108 (GRCm39) N217K probably benign Het
Vmn2r87 T C 10: 130,308,367 (GRCm39) I624V probably damaging Het
Wdr4 A G 17: 31,718,129 (GRCm39) V315A probably benign Het
Xpo7 T C 14: 70,914,256 (GRCm39) probably null Het
Zfp827 T A 8: 79,787,403 (GRCm39) W190R probably damaging Het
Zfp971 A G 2: 177,674,940 (GRCm39) T180A probably benign Het
Zfp980 G A 4: 145,428,653 (GRCm39) G461S probably benign Het
Other mutations in Dnase1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4691:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4752:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4753:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4814:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4815:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4846:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4861:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4862:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4872:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4875:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4978:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4979:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4980:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4981:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4982:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4983:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5039:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5084:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5085:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5086:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5087:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5106:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5107:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5108:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5109:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5137:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5171:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5266:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5296:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5330:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5417:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5418:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5419:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5448:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5450:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5466:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5467:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6126:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6128:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6129:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6130:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6232:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6233:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6234:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6242:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6305:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6306:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6329:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6343:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6344:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6396:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6397:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6449:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6450:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6585:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6586:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6646:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6679:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6681:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6845:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6847:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R8526:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGATTGGTACCAGAGTGGCTG -3'
(R):5'- TTGGAGGGTTCCTGATGCAC -3'

Sequencing Primer
(F):5'- TACCAGAGTGGCTGCAGAC -3'
(R):5'- GGTTCCTGATGCACACATAGCAATG -3'
Posted On 2016-03-17