Incidental Mutation 'R4876:Plxna2'
ID376847
Institutional Source Beutler Lab
Gene Symbol Plxna2
Ensembl Gene ENSMUSG00000026640
Gene Nameplexin A2
Synonyms2810428A13Rik, OCT, PlexA2, Plxn2
MMRRC Submission 042485-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4876 (G1)
Quality Score163
Status Validated
Chromosome1
Chromosomal Location194618218-194816869 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 194643775 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 6 (F6I)
Ref Sequence ENSEMBL: ENSMUSP00000027952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027952]
PDB Structure
Plexin A2 / Semaphorin 6A complex [X-RAY DIFFRACTION]
Mouse Plexin A2 extracellular domain [X-RAY DIFFRACTION]
Mouse Plexin A2, extracellular domains 1-4 [X-RAY DIFFRACTION]
Plexin A2 in complex with Semaphorin 6A [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000027952
AA Change: F6I

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000027952
Gene: ENSMUSG00000026640
AA Change: F6I

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
Sema 50 492 1.65e-132 SMART
PSI 510 560 8e-12 SMART
PSI 655 702 6.35e-6 SMART
PSI 803 856 1.24e-8 SMART
IPT 857 952 6.36e-21 SMART
IPT 953 1038 1.02e-24 SMART
IPT 1040 1140 1.48e-21 SMART
IPT 1142 1237 8.81e-6 SMART
transmembrane domain 1238 1260 N/A INTRINSIC
Pfam:Plexin_cytopl 1311 1864 1.9e-261 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125381
Meta Mutation Damage Score 0.1256 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on axon pathfinding during nervous system development. A subset of semaphorins are recognized by plexin-A/neuropilin transmembrane receptor complexes, triggering a cellular signal transduction cascade that leads to axon repulsion. This plexin-A family member is thought to transduce signals from semaphorin-3A and -3C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show abnormal granule cell migration in the adult cerebellum and aberrant projection of mossy fibers in hippocampal slices. Mice homozygous for an ENU-induced allele are smaller and show granule cell migration defects and mild ataxia with incomplete penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik C T 9: 94,537,577 R100H probably damaging Het
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
9530053A07Rik A T 7: 28,142,800 probably benign Het
A630001G21Rik C T 1: 85,719,040 V167M probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano4 A G 10: 89,112,835 F138L probably damaging Het
Aoc1 T C 6: 48,906,747 V519A possibly damaging Het
Arhgef37 A T 18: 61,498,239 Y558* probably null Het
Atxn3 T A 12: 101,948,379 S29C probably damaging Het
Bbs2 T C 8: 94,070,160 probably benign Het
BC052040 A C 2: 115,670,058 H159P probably damaging Het
Bicral A T 17: 46,825,576 I236N probably damaging Het
Cabcoco1 A G 10: 68,541,769 V30A probably benign Het
Cap2 A G 13: 46,531,021 M1V probably null Het
Ccdc153 T C 9: 44,241,008 M1T probably null Het
Ccnf A T 17: 24,230,337 V489D probably damaging Het
Cntnap3 T C 13: 64,787,706 T448A probably benign Het
Cpa4 G A 6: 30,590,815 D371N probably benign Het
Csl T A 10: 99,758,540 Y221F possibly damaging Het
Dalrd3 T C 9: 108,571,436 probably benign Het
Dennd4a T A 9: 64,896,590 N1070K probably benign Het
Dmwd A T 7: 19,080,547 D374V probably damaging Het
Eea1 G T 10: 95,995,613 A189S probably benign Het
Fasn A G 11: 120,812,312 V1629A probably damaging Het
Fndc1 T C 17: 7,771,639 D1075G unknown Het
Fsip2 A G 2: 82,974,858 N507S possibly damaging Het
Gabra5 T G 7: 57,413,665 E337A probably damaging Het
Gsg1l A G 7: 125,891,669 Y288H probably benign Het
H2-M11 A T 17: 36,547,509 D65V probably benign Het
Hmgxb3 A T 18: 61,146,534 C736S possibly damaging Het
Hsd3b3 A T 3: 98,742,644 I121N probably damaging Het
Ikbke GCC G 1: 131,275,267 probably null Het
Il16 A C 7: 83,673,094 S338A probably benign Het
Itpr1 G A 6: 108,482,906 A2054T probably damaging Het
Lamp3 T A 16: 19,655,470 I385F probably damaging Het
Limch1 G A 5: 66,881,927 V66I possibly damaging Het
Lmod2 A G 6: 24,604,279 R418G probably benign Het
Ly6g6c A T 17: 35,069,440 D96V probably damaging Het
Map2k2 G A 10: 81,115,113 V131M probably damaging Het
Mapk9 T C 11: 49,854,325 V22A probably damaging Het
Mettl2 T C 11: 105,129,068 I177T probably damaging Het
Mob4 C T 1: 55,152,836 probably benign Het
Mybpc1 T C 10: 88,522,991 I1113V probably benign Het
Mybpc1 A T 10: 88,536,424 N781K probably benign Het
Myom1 A G 17: 71,077,410 T707A probably damaging Het
Ncam2 G A 16: 81,490,346 A383T probably benign Het
Nomo1 T C 7: 46,066,491 S761P probably damaging Het
Nsd3 T A 8: 25,691,134 S921T possibly damaging Het
Olfr268-ps1 C G 2: 111,844,695 noncoding transcript Het
Olfr934 A T 9: 38,982,626 C139* probably null Het
Olfr985 C T 9: 40,127,218 V248I probably damaging Het
Omp A T 7: 98,145,026 D131E probably benign Het
Pard3 T C 8: 127,561,469 probably benign Het
Parg A G 14: 32,271,668 T286A probably damaging Het
Parp1 T A 1: 180,569,035 M1K probably null Het
Pclo T A 5: 14,811,680 S4882R unknown Het
Pcnx2 C T 8: 125,772,108 E1551K probably damaging Het
Pcyox1l A G 18: 61,699,494 Y161H probably damaging Het
Pdzd8 A T 19: 59,300,804 C721* probably null Het
Piwil4 T C 9: 14,740,465 D90G probably benign Het
Plxdc2 T A 2: 16,703,318 C306S probably damaging Het
Prkaa1 T C 15: 5,174,405 M265T probably benign Het
Prrc2b T C 2: 32,214,200 V1230A probably benign Het
Rfx2 T C 17: 56,784,706 E329G probably benign Het
Scg2 T C 1: 79,435,919 I322M probably damaging Het
Scly T A 1: 91,320,128 N399K probably damaging Het
Sec23b T A 2: 144,586,361 probably null Het
Sephs2 A T 7: 127,273,047 Y291* probably null Het
Slc45a3 T C 1: 131,981,547 I494T possibly damaging Het
Slc6a21 C A 7: 45,280,111 Y76* probably null Het
Slfn14 T A 11: 83,276,272 I806L possibly damaging Het
Slfn4 T A 11: 83,187,018 S211T probably benign Het
Sptbn4 A G 7: 27,372,152 V1624A probably damaging Het
Sugp1 T A 8: 70,071,184 M567K probably damaging Het
Tmem121 A T 12: 113,188,728 M189L probably benign Het
Tmem201 A G 4: 149,722,270 S444P probably damaging Het
Tmem63a T C 1: 180,973,186 V744A probably benign Het
Tnrc18 G A 5: 142,731,625 S2358F unknown Het
Ubash3b A G 9: 41,018,109 V404A probably benign Het
Unc13c A T 9: 73,749,539 C1127S probably damaging Het
Unc5a T C 13: 54,997,229 V253A probably benign Het
Vmn1r-ps123 C T 13: 22,996,365 noncoding transcript Het
Wdr74 A G 19: 8,739,485 E253G possibly damaging Het
Wwox T C 8: 114,448,248 Y107H probably damaging Het
Zdhhc22 A T 12: 86,988,238 Y147N probably damaging Het
Zfp131 T C 13: 119,788,955 H44R possibly damaging Het
Zfp235 A G 7: 24,140,959 T268A probably benign Het
Zfp280d T C 9: 72,298,858 probably benign Het
Zfp358 T C 8: 3,496,170 S251P probably damaging Het
Other mutations in Plxna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Plxna2 APN 1 194644657 missense probably damaging 1.00
IGL00332:Plxna2 APN 1 194789830 missense probably damaging 0.98
IGL00392:Plxna2 APN 1 194800568 missense probably damaging 1.00
IGL00432:Plxna2 APN 1 194644096 missense probably benign 0.03
IGL00704:Plxna2 APN 1 194751461 missense probably damaging 0.99
IGL00737:Plxna2 APN 1 194746239 splice site probably benign
IGL01078:Plxna2 APN 1 194786693 unclassified probably benign
IGL01354:Plxna2 APN 1 194762435 missense probably benign 0.02
IGL01432:Plxna2 APN 1 194644318 missense possibly damaging 0.58
IGL01459:Plxna2 APN 1 194764570 missense probably benign 0.00
IGL01525:Plxna2 APN 1 194712311 missense probably benign 0.00
IGL01656:Plxna2 APN 1 194790161 missense possibly damaging 0.52
IGL01825:Plxna2 APN 1 194788902 missense probably damaging 0.98
IGL01862:Plxna2 APN 1 194643950 missense possibly damaging 0.87
IGL01899:Plxna2 APN 1 194751488 missense probably damaging 1.00
IGL01996:Plxna2 APN 1 194799776 missense probably damaging 0.99
IGL02123:Plxna2 APN 1 194794383 missense probably damaging 1.00
IGL02226:Plxna2 APN 1 194644424 missense probably damaging 1.00
IGL02227:Plxna2 APN 1 194752089 missense probably damaging 1.00
IGL02415:Plxna2 APN 1 194643964 missense probably damaging 1.00
IGL02440:Plxna2 APN 1 194746150 missense probably benign 0.10
IGL02545:Plxna2 APN 1 194786690 unclassified probably benign
IGL02553:Plxna2 APN 1 194751438 missense probably benign 0.08
IGL02882:Plxna2 APN 1 194762570 missense probably damaging 1.00
IGL02946:Plxna2 APN 1 194749309 splice site probably benign
IGL03062:Plxna2 APN 1 194762550 missense possibly damaging 0.72
IGL03095:Plxna2 APN 1 194801127 missense probably damaging 1.00
IGL03293:Plxna2 APN 1 194804945 missense probably damaging 0.99
R0024:Plxna2 UTSW 1 194643995 missense possibly damaging 0.57
R0040:Plxna2 UTSW 1 194643896 missense probably benign 0.13
R0040:Plxna2 UTSW 1 194643896 missense probably benign 0.13
R0063:Plxna2 UTSW 1 194644939 missense probably benign 0.00
R0063:Plxna2 UTSW 1 194644939 missense probably benign 0.00
R0217:Plxna2 UTSW 1 194644598 missense probably damaging 1.00
R0316:Plxna2 UTSW 1 194644150 missense probably damaging 1.00
R0440:Plxna2 UTSW 1 194644404 nonsense probably null
R0505:Plxna2 UTSW 1 194644348 missense possibly damaging 0.93
R0568:Plxna2 UTSW 1 194751386 missense probably benign 0.00
R0669:Plxna2 UTSW 1 194788837 missense probably damaging 0.99
R0674:Plxna2 UTSW 1 194649475 missense probably benign 0.00
R0885:Plxna2 UTSW 1 194644556 missense probably benign
R0898:Plxna2 UTSW 1 194797024 missense probably damaging 1.00
R0940:Plxna2 UTSW 1 194800555 missense probably benign 0.01
R1061:Plxna2 UTSW 1 194644093 missense probably damaging 1.00
R1067:Plxna2 UTSW 1 194780510 splice site probably null
R1222:Plxna2 UTSW 1 194800649 missense probably damaging 1.00
R1345:Plxna2 UTSW 1 194644486 missense probably damaging 1.00
R1363:Plxna2 UTSW 1 194804939 nonsense probably null
R1432:Plxna2 UTSW 1 194767463 missense probably benign 0.10
R1434:Plxna2 UTSW 1 194751540 splice site probably benign
R1597:Plxna2 UTSW 1 194749306 splice site probably benign
R1719:Plxna2 UTSW 1 194644370 missense possibly damaging 0.93
R1778:Plxna2 UTSW 1 194810970 missense probably benign 0.01
R1795:Plxna2 UTSW 1 194806303 missense probably damaging 0.99
R1819:Plxna2 UTSW 1 194790186 missense probably benign 0.03
R1926:Plxna2 UTSW 1 194762450 missense probably benign 0.02
R1966:Plxna2 UTSW 1 194644700 missense possibly damaging 0.91
R1987:Plxna2 UTSW 1 194643989 missense probably damaging 1.00
R1988:Plxna2 UTSW 1 194643989 missense probably damaging 1.00
R2034:Plxna2 UTSW 1 194780594 missense probably benign 0.00
R2131:Plxna2 UTSW 1 194644750 missense probably benign 0.01
R2171:Plxna2 UTSW 1 194800617 missense probably damaging 1.00
R2217:Plxna2 UTSW 1 194797748 missense probably damaging 1.00
R2311:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2340:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2342:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2423:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2424:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2425:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2842:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2971:Plxna2 UTSW 1 194797731 missense probably damaging 1.00
R3236:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R3731:Plxna2 UTSW 1 194788885 missense probably benign 0.42
R3783:Plxna2 UTSW 1 194807521 missense probably damaging 1.00
R3784:Plxna2 UTSW 1 194644617 missense probably benign
R3787:Plxna2 UTSW 1 194643934 missense probably benign 0.10
R3845:Plxna2 UTSW 1 194793790 missense probably damaging 0.96
R3927:Plxna2 UTSW 1 194746157 missense probably benign 0.02
R3930:Plxna2 UTSW 1 194794910 missense probably benign 0.17
R3964:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R3980:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4067:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4120:Plxna2 UTSW 1 194780627 missense probably damaging 1.00
R4231:Plxna2 UTSW 1 194644454 missense probably damaging 1.00
R4257:Plxna2 UTSW 1 194644775 missense probably damaging 1.00
R4396:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4397:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4418:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4444:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4446:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4482:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4487:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4489:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4571:Plxna2 UTSW 1 194810988 missense possibly damaging 0.91
R4622:Plxna2 UTSW 1 194812150 missense probably benign
R4623:Plxna2 UTSW 1 194812150 missense probably benign
R4684:Plxna2 UTSW 1 194762594 missense probably benign 0.42
R4688:Plxna2 UTSW 1 194644445 missense probably damaging 1.00
R4855:Plxna2 UTSW 1 194797732 missense probably benign 0.39
R5161:Plxna2 UTSW 1 194751404 missense probably benign
R5207:Plxna2 UTSW 1 194788899 missense probably benign 0.19
R5479:Plxna2 UTSW 1 194793873 missense probably benign
R5931:Plxna2 UTSW 1 194810870 missense probably damaging 1.00
R6026:Plxna2 UTSW 1 194799814 missense probably damaging 1.00
R6029:Plxna2 UTSW 1 194794427 missense probably benign 0.00
R6029:Plxna2 UTSW 1 194799575 missense probably damaging 1.00
R6059:Plxna2 UTSW 1 194810971 missense possibly damaging 0.79
R6238:Plxna2 UTSW 1 194790196 missense probably benign 0.01
R6322:Plxna2 UTSW 1 194754367 missense possibly damaging 0.89
R6668:Plxna2 UTSW 1 194810088 missense possibly damaging 0.68
R6709:Plxna2 UTSW 1 194789766 missense probably benign 0.01
R6748:Plxna2 UTSW 1 194794182 intron probably null
R6838:Plxna2 UTSW 1 194804914 missense possibly damaging 0.90
R6844:Plxna2 UTSW 1 194793828 missense probably benign 0.08
R7069:Plxna2 UTSW 1 194793904 missense possibly damaging 0.51
R7122:Plxna2 UTSW 1 194644568 nonsense probably null
R7145:Plxna2 UTSW 1 194649522 missense not run
X0027:Plxna2 UTSW 1 194644433 missense probably damaging 1.00
Z1088:Plxna2 UTSW 1 194644441 missense possibly damaging 0.56
Z1088:Plxna2 UTSW 1 194764539 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GATTCCCTTAGCAACCTTGGG -3'
(R):5'- GTAGACACGATTGATAGCCCC -3'

Sequencing Primer
(F):5'- TGTAGCAAAAGAAACTCATAGCAC -3'
(R):5'- CGATTGATAGCCCCCACATAC -3'
Posted On2016-03-17