Incidental Mutation 'R4876:Prrc2b'
ID376848
Institutional Source Beutler Lab
Gene Symbol Prrc2b
Ensembl Gene ENSMUSG00000039262
Gene Nameproline-rich coiled-coil 2B
Synonyms5830434P21Rik, Bat2l
MMRRC Submission 042485-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4876 (G1)
Quality Score171
Status Validated
Chromosome2
Chromosomal Location32151082-32234537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32214200 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1230 (V1230A)
Ref Sequence ENSEMBL: ENSMUSP00000064892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036691] [ENSMUST00000069817]
Predicted Effect probably benign
Transcript: ENSMUST00000036691
SMART Domains Protein: ENSMUSP00000035734
Gene: ENSMUSG00000039262

DomainStartEndE-ValueType
Pfam:BAT2_N 1 194 2.7e-85 PFAM
low complexity region 359 374 N/A INTRINSIC
low complexity region 388 394 N/A INTRINSIC
low complexity region 413 424 N/A INTRINSIC
coiled coil region 494 544 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 638 656 N/A INTRINSIC
low complexity region 885 900 N/A INTRINSIC
low complexity region 992 1007 N/A INTRINSIC
low complexity region 1112 1126 N/A INTRINSIC
low complexity region 1218 1233 N/A INTRINSIC
low complexity region 1257 1275 N/A INTRINSIC
low complexity region 1402 1421 N/A INTRINSIC
low complexity region 1425 1437 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069817
AA Change: V1230A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000064892
Gene: ENSMUSG00000039262
AA Change: V1230A

DomainStartEndE-ValueType
Pfam:BAT2_N 1 191 3.1e-65 PFAM
low complexity region 359 374 N/A INTRINSIC
low complexity region 388 394 N/A INTRINSIC
low complexity region 413 424 N/A INTRINSIC
coiled coil region 494 544 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 638 656 N/A INTRINSIC
low complexity region 960 977 N/A INTRINSIC
low complexity region 1004 1018 N/A INTRINSIC
low complexity region 1070 1094 N/A INTRINSIC
low complexity region 1307 1325 N/A INTRINSIC
low complexity region 1388 1401 N/A INTRINSIC
low complexity region 1413 1426 N/A INTRINSIC
low complexity region 1572 1587 N/A INTRINSIC
low complexity region 1678 1693 N/A INTRINSIC
low complexity region 1798 1812 N/A INTRINSIC
low complexity region 1904 1919 N/A INTRINSIC
low complexity region 1943 1961 N/A INTRINSIC
low complexity region 2088 2107 N/A INTRINSIC
low complexity region 2111 2123 N/A INTRINSIC
low complexity region 2161 2174 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123270
Predicted Effect probably benign
Transcript: ENSMUST00000128936
SMART Domains Protein: ENSMUSP00000121664
Gene: ENSMUSG00000039262

DomainStartEndE-ValueType
low complexity region 53 68 N/A INTRINSIC
low complexity region 159 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132459
SMART Domains Protein: ENSMUSP00000116429
Gene: ENSMUSG00000039262

DomainStartEndE-ValueType
Pfam:BAT2_N 1 119 9.8e-24 PFAM
low complexity region 287 302 N/A INTRINSIC
low complexity region 316 322 N/A INTRINSIC
low complexity region 341 352 N/A INTRINSIC
coiled coil region 421 471 N/A INTRINSIC
low complexity region 528 549 N/A INTRINSIC
low complexity region 566 584 N/A INTRINSIC
low complexity region 813 828 N/A INTRINSIC
low complexity region 920 935 N/A INTRINSIC
low complexity region 1040 1054 N/A INTRINSIC
low complexity region 1146 1161 N/A INTRINSIC
low complexity region 1185 1203 N/A INTRINSIC
low complexity region 1330 1349 N/A INTRINSIC
low complexity region 1353 1365 N/A INTRINSIC
low complexity region 1403 1416 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142219
Predicted Effect probably benign
Transcript: ENSMUST00000156313
SMART Domains Protein: ENSMUSP00000114994
Gene: ENSMUSG00000039262

DomainStartEndE-ValueType
low complexity region 125 140 N/A INTRINSIC
low complexity region 231 246 N/A INTRINSIC
Meta Mutation Damage Score 0.016 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 99% (97/98)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik C T 9: 94,537,577 R100H probably damaging Het
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
9530053A07Rik A T 7: 28,142,800 probably benign Het
A630001G21Rik C T 1: 85,719,040 V167M probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano4 A G 10: 89,112,835 F138L probably damaging Het
Aoc1 T C 6: 48,906,747 V519A possibly damaging Het
Arhgef37 A T 18: 61,498,239 Y558* probably null Het
Atxn3 T A 12: 101,948,379 S29C probably damaging Het
Bbs2 T C 8: 94,070,160 probably benign Het
BC052040 A C 2: 115,670,058 H159P probably damaging Het
Bicral A T 17: 46,825,576 I236N probably damaging Het
Cabcoco1 A G 10: 68,541,769 V30A probably benign Het
Cap2 A G 13: 46,531,021 M1V probably null Het
Ccdc153 T C 9: 44,241,008 M1T probably null Het
Ccnf A T 17: 24,230,337 V489D probably damaging Het
Cntnap3 T C 13: 64,787,706 T448A probably benign Het
Cpa4 G A 6: 30,590,815 D371N probably benign Het
Csl T A 10: 99,758,540 Y221F possibly damaging Het
Dalrd3 T C 9: 108,571,436 probably benign Het
Dennd4a T A 9: 64,896,590 N1070K probably benign Het
Dmwd A T 7: 19,080,547 D374V probably damaging Het
Eea1 G T 10: 95,995,613 A189S probably benign Het
Fasn A G 11: 120,812,312 V1629A probably damaging Het
Fndc1 T C 17: 7,771,639 D1075G unknown Het
Fsip2 A G 2: 82,974,858 N507S possibly damaging Het
Gabra5 T G 7: 57,413,665 E337A probably damaging Het
Gsg1l A G 7: 125,891,669 Y288H probably benign Het
H2-M11 A T 17: 36,547,509 D65V probably benign Het
Hmgxb3 A T 18: 61,146,534 C736S possibly damaging Het
Hsd3b3 A T 3: 98,742,644 I121N probably damaging Het
Ikbke GCC G 1: 131,275,267 probably null Het
Il16 A C 7: 83,673,094 S338A probably benign Het
Itpr1 G A 6: 108,482,906 A2054T probably damaging Het
Lamp3 T A 16: 19,655,470 I385F probably damaging Het
Limch1 G A 5: 66,881,927 V66I possibly damaging Het
Lmod2 A G 6: 24,604,279 R418G probably benign Het
Ly6g6c A T 17: 35,069,440 D96V probably damaging Het
Map2k2 G A 10: 81,115,113 V131M probably damaging Het
Mapk9 T C 11: 49,854,325 V22A probably damaging Het
Mettl2 T C 11: 105,129,068 I177T probably damaging Het
Mob4 C T 1: 55,152,836 probably benign Het
Mybpc1 T C 10: 88,522,991 I1113V probably benign Het
Mybpc1 A T 10: 88,536,424 N781K probably benign Het
Myom1 A G 17: 71,077,410 T707A probably damaging Het
Ncam2 G A 16: 81,490,346 A383T probably benign Het
Nomo1 T C 7: 46,066,491 S761P probably damaging Het
Nsd3 T A 8: 25,691,134 S921T possibly damaging Het
Olfr268-ps1 C G 2: 111,844,695 noncoding transcript Het
Olfr934 A T 9: 38,982,626 C139* probably null Het
Olfr985 C T 9: 40,127,218 V248I probably damaging Het
Omp A T 7: 98,145,026 D131E probably benign Het
Pard3 T C 8: 127,561,469 probably benign Het
Parg A G 14: 32,271,668 T286A probably damaging Het
Parp1 T A 1: 180,569,035 M1K probably null Het
Pclo T A 5: 14,811,680 S4882R unknown Het
Pcnx2 C T 8: 125,772,108 E1551K probably damaging Het
Pcyox1l A G 18: 61,699,494 Y161H probably damaging Het
Pdzd8 A T 19: 59,300,804 C721* probably null Het
Piwil4 T C 9: 14,740,465 D90G probably benign Het
Plxdc2 T A 2: 16,703,318 C306S probably damaging Het
Plxna2 T A 1: 194,643,775 F6I probably benign Het
Prkaa1 T C 15: 5,174,405 M265T probably benign Het
Rfx2 T C 17: 56,784,706 E329G probably benign Het
Scg2 T C 1: 79,435,919 I322M probably damaging Het
Scly T A 1: 91,320,128 N399K probably damaging Het
Sec23b T A 2: 144,586,361 probably null Het
Sephs2 A T 7: 127,273,047 Y291* probably null Het
Slc45a3 T C 1: 131,981,547 I494T possibly damaging Het
Slc6a21 C A 7: 45,280,111 Y76* probably null Het
Slfn14 T A 11: 83,276,272 I806L possibly damaging Het
Slfn4 T A 11: 83,187,018 S211T probably benign Het
Sptbn4 A G 7: 27,372,152 V1624A probably damaging Het
Sugp1 T A 8: 70,071,184 M567K probably damaging Het
Tmem121 A T 12: 113,188,728 M189L probably benign Het
Tmem201 A G 4: 149,722,270 S444P probably damaging Het
Tmem63a T C 1: 180,973,186 V744A probably benign Het
Tnrc18 G A 5: 142,731,625 S2358F unknown Het
Ubash3b A G 9: 41,018,109 V404A probably benign Het
Unc13c A T 9: 73,749,539 C1127S probably damaging Het
Unc5a T C 13: 54,997,229 V253A probably benign Het
Vmn1r-ps123 C T 13: 22,996,365 noncoding transcript Het
Wdr74 A G 19: 8,739,485 E253G possibly damaging Het
Wwox T C 8: 114,448,248 Y107H probably damaging Het
Zdhhc22 A T 12: 86,988,238 Y147N probably damaging Het
Zfp131 T C 13: 119,788,955 H44R possibly damaging Het
Zfp235 A G 7: 24,140,959 T268A probably benign Het
Zfp280d T C 9: 72,298,858 probably benign Het
Zfp358 T C 8: 3,496,170 S251P probably damaging Het
Other mutations in Prrc2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Prrc2b APN 2 32208719 missense probably damaging 1.00
IGL00846:Prrc2b APN 2 32199097 splice site probably benign
IGL00977:Prrc2b APN 2 32213810 missense probably benign 0.05
IGL01372:Prrc2b APN 2 32223930 missense probably damaging 0.99
IGL01993:Prrc2b APN 2 32224045 missense possibly damaging 0.47
IGL02097:Prrc2b APN 2 32191501 splice site probably benign
IGL02165:Prrc2b APN 2 32214640 missense probably damaging 1.00
IGL02184:Prrc2b APN 2 32221455 missense probably benign 0.19
IGL02238:Prrc2b APN 2 32213417 missense probably damaging 1.00
IGL02338:Prrc2b APN 2 32214035 missense probably benign 0.01
IGL02399:Prrc2b APN 2 32226961 nonsense probably null
IGL02597:Prrc2b APN 2 32219613 missense probably damaging 1.00
IGL02729:Prrc2b APN 2 32208758 missense probably damaging 0.99
IGL02743:Prrc2b APN 2 32194429 missense probably damaging 1.00
IGL02815:Prrc2b APN 2 32204253 missense probably damaging 1.00
IGL03159:Prrc2b APN 2 32194486 missense probably damaging 0.98
FR4304:Prrc2b UTSW 2 32221167 missense probably damaging 1.00
R0082:Prrc2b UTSW 2 32212298 splice site probably benign
R0105:Prrc2b UTSW 2 32213311 nonsense probably null
R0276:Prrc2b UTSW 2 32219654 missense probably damaging 0.97
R0325:Prrc2b UTSW 2 32199091 missense probably damaging 1.00
R0436:Prrc2b UTSW 2 32230660 missense probably damaging 1.00
R0595:Prrc2b UTSW 2 32183177 missense probably damaging 1.00
R0607:Prrc2b UTSW 2 32213870 missense probably damaging 0.99
R0650:Prrc2b UTSW 2 32229255 splice site probably benign
R1282:Prrc2b UTSW 2 32223444 missense probably damaging 0.96
R1421:Prrc2b UTSW 2 32200978 missense possibly damaging 0.65
R1452:Prrc2b UTSW 2 32194985 missense probably damaging 1.00
R1535:Prrc2b UTSW 2 32204289 missense probably benign 0.06
R1709:Prrc2b UTSW 2 32194461 missense probably damaging 1.00
R1710:Prrc2b UTSW 2 32212222 missense probably damaging 0.99
R2094:Prrc2b UTSW 2 32182570 missense probably damaging 1.00
R2202:Prrc2b UTSW 2 32223464 missense probably damaging 1.00
R2203:Prrc2b UTSW 2 32223464 missense probably damaging 1.00
R2204:Prrc2b UTSW 2 32223464 missense probably damaging 1.00
R2428:Prrc2b UTSW 2 32216055 missense probably benign 0.00
R2435:Prrc2b UTSW 2 32219729 missense probably damaging 0.99
R3439:Prrc2b UTSW 2 32206347 missense probably benign 0.01
R4175:Prrc2b UTSW 2 32218808 intron probably benign
R4710:Prrc2b UTSW 2 32193857 missense possibly damaging 0.80
R4728:Prrc2b UTSW 2 32230625 missense probably damaging 1.00
R4791:Prrc2b UTSW 2 32217339 splice site probably null
R4908:Prrc2b UTSW 2 32226318 missense possibly damaging 0.94
R4997:Prrc2b UTSW 2 32222311 missense probably damaging 1.00
R5240:Prrc2b UTSW 2 32206396 missense probably benign 0.01
R5276:Prrc2b UTSW 2 32214722 missense probably benign 0.09
R5455:Prrc2b UTSW 2 32221343 critical splice acceptor site probably null
R5821:Prrc2b UTSW 2 32212132 missense probably damaging 0.99
R5835:Prrc2b UTSW 2 32206473 missense probably benign 0.18
R5958:Prrc2b UTSW 2 32212080 missense possibly damaging 0.89
R6052:Prrc2b UTSW 2 32212285 missense possibly damaging 0.92
R6218:Prrc2b UTSW 2 32208811 missense probably damaging 1.00
R6428:Prrc2b UTSW 2 32226496 intron probably null
R6505:Prrc2b UTSW 2 32222320 missense probably damaging 1.00
R6812:Prrc2b UTSW 2 32213141 missense probably benign 0.30
R6826:Prrc2b UTSW 2 32222288 critical splice acceptor site probably null
R6827:Prrc2b UTSW 2 32200951 missense probably benign 0.37
R7021:Prrc2b UTSW 2 32221486 missense probably damaging 1.00
R7078:Prrc2b UTSW 2 32213519 missense probably benign 0.01
R7081:Prrc2b UTSW 2 32213063 missense probably benign 0.12
R7101:Prrc2b UTSW 2 32226993 missense possibly damaging 0.68
R7215:Prrc2b UTSW 2 32229297 missense probably damaging 1.00
R7228:Prrc2b UTSW 2 32214306 nonsense probably null
Z1088:Prrc2b UTSW 2 32214429 missense probably benign 0.03
Z1088:Prrc2b UTSW 2 32216732 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGTATGAAGAGCTGCCCAAG -3'
(R):5'- AATCTGCCCCATGGTCATC -3'

Sequencing Primer
(F):5'- TCTGAGCATAGCCACGAGG -3'
(R):5'- GGTCATCTTGGAAAAAGGACCTCTTG -3'
Posted On2016-03-17