Incidental Mutation 'R4876:Il16'
ID376869
Institutional Source Beutler Lab
Gene Symbol Il16
Ensembl Gene ENSMUSG00000001741
Gene Nameinterleukin 16
Synonyms
MMRRC Submission 042485-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R4876 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location83642825-83745726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 83673094 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 338 (S338A)
Ref Sequence ENSEMBL: ENSMUSP00000001792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001792] [ENSMUST00000153560]
Predicted Effect probably benign
Transcript: ENSMUST00000001792
AA Change: S338A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001792
Gene: ENSMUSG00000001741
AA Change: S338A

DomainStartEndE-ValueType
low complexity region 76 92 N/A INTRINSIC
low complexity region 99 115 N/A INTRINSIC
PDZ 222 300 6.5e-23 SMART
PDZ 361 438 3.89e-12 SMART
low complexity region 507 526 N/A INTRINSIC
low complexity region 556 577 N/A INTRINSIC
low complexity region 589 602 N/A INTRINSIC
low complexity region 647 680 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 825 839 N/A INTRINSIC
low complexity region 978 989 N/A INTRINSIC
PDZ 1115 1192 3.6e-16 SMART
low complexity region 1201 1216 N/A INTRINSIC
PDZ 1234 1310 4.11e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153560
SMART Domains Protein: ENSMUSP00000118516
Gene: ENSMUSG00000001741

DomainStartEndE-ValueType
low complexity region 76 92 N/A INTRINSIC
low complexity region 99 115 N/A INTRINSIC
Meta Mutation Damage Score 0.154 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pleiotropic cytokine that functions as a chemoattractant, a modulator of T cell activation, and an inhibitor of HIV replication. The signaling process of this cytokine is mediated by CD4. The product of this gene undergoes proteolytic processing, which is found to yield two functional proteins. The cytokine function is exclusively attributed to the secreted C-terminal peptide, while the N-terminal product may play a role in cell cycle control. Caspase 3 is reported to be involved in the proteolytic processing of this protein. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele display a transient but consistent increase of thymidine incorporation in anti-CD3-stimulated CD4+ T cells, but fail to show a hyperproliferative T cell phenotype using BrdU labeling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik C T 9: 94,537,577 R100H probably damaging Het
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
9530053A07Rik A T 7: 28,142,800 probably benign Het
A630001G21Rik C T 1: 85,719,040 V167M probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano4 A G 10: 89,112,835 F138L probably damaging Het
Aoc1 T C 6: 48,906,747 V519A possibly damaging Het
Arhgef37 A T 18: 61,498,239 Y558* probably null Het
Atxn3 T A 12: 101,948,379 S29C probably damaging Het
Bbs2 T C 8: 94,070,160 probably benign Het
BC052040 A C 2: 115,670,058 H159P probably damaging Het
Bicral A T 17: 46,825,576 I236N probably damaging Het
Cabcoco1 A G 10: 68,541,769 V30A probably benign Het
Cap2 A G 13: 46,531,021 M1V probably null Het
Ccdc153 T C 9: 44,241,008 M1T probably null Het
Ccnf A T 17: 24,230,337 V489D probably damaging Het
Cntnap3 T C 13: 64,787,706 T448A probably benign Het
Cpa4 G A 6: 30,590,815 D371N probably benign Het
Csl T A 10: 99,758,540 Y221F possibly damaging Het
Dalrd3 T C 9: 108,571,436 probably benign Het
Dennd4a T A 9: 64,896,590 N1070K probably benign Het
Dmwd A T 7: 19,080,547 D374V probably damaging Het
Eea1 G T 10: 95,995,613 A189S probably benign Het
Fasn A G 11: 120,812,312 V1629A probably damaging Het
Fndc1 T C 17: 7,771,639 D1075G unknown Het
Fsip2 A G 2: 82,974,858 N507S possibly damaging Het
Gabra5 T G 7: 57,413,665 E337A probably damaging Het
Gsg1l A G 7: 125,891,669 Y288H probably benign Het
H2-M11 A T 17: 36,547,509 D65V probably benign Het
Hmgxb3 A T 18: 61,146,534 C736S possibly damaging Het
Hsd3b3 A T 3: 98,742,644 I121N probably damaging Het
Ikbke GCC G 1: 131,275,267 probably null Het
Itpr1 G A 6: 108,482,906 A2054T probably damaging Het
Lamp3 T A 16: 19,655,470 I385F probably damaging Het
Limch1 G A 5: 66,881,927 V66I possibly damaging Het
Lmod2 A G 6: 24,604,279 R418G probably benign Het
Ly6g6c A T 17: 35,069,440 D96V probably damaging Het
Map2k2 G A 10: 81,115,113 V131M probably damaging Het
Mapk9 T C 11: 49,854,325 V22A probably damaging Het
Mettl2 T C 11: 105,129,068 I177T probably damaging Het
Mob4 C T 1: 55,152,836 probably benign Het
Mybpc1 T C 10: 88,522,991 I1113V probably benign Het
Mybpc1 A T 10: 88,536,424 N781K probably benign Het
Myom1 A G 17: 71,077,410 T707A probably damaging Het
Ncam2 G A 16: 81,490,346 A383T probably benign Het
Nomo1 T C 7: 46,066,491 S761P probably damaging Het
Nsd3 T A 8: 25,691,134 S921T possibly damaging Het
Olfr268-ps1 C G 2: 111,844,695 noncoding transcript Het
Olfr934 A T 9: 38,982,626 C139* probably null Het
Olfr985 C T 9: 40,127,218 V248I probably damaging Het
Omp A T 7: 98,145,026 D131E probably benign Het
Pard3 T C 8: 127,561,469 probably benign Het
Parg A G 14: 32,271,668 T286A probably damaging Het
Parp1 T A 1: 180,569,035 M1K probably null Het
Pclo T A 5: 14,811,680 S4882R unknown Het
Pcnx2 C T 8: 125,772,108 E1551K probably damaging Het
Pcyox1l A G 18: 61,699,494 Y161H probably damaging Het
Pdzd8 A T 19: 59,300,804 C721* probably null Het
Piwil4 T C 9: 14,740,465 D90G probably benign Het
Plxdc2 T A 2: 16,703,318 C306S probably damaging Het
Plxna2 T A 1: 194,643,775 F6I probably benign Het
Prkaa1 T C 15: 5,174,405 M265T probably benign Het
Prrc2b T C 2: 32,214,200 V1230A probably benign Het
Rfx2 T C 17: 56,784,706 E329G probably benign Het
Scg2 T C 1: 79,435,919 I322M probably damaging Het
Scly T A 1: 91,320,128 N399K probably damaging Het
Sec23b T A 2: 144,586,361 probably null Het
Sephs2 A T 7: 127,273,047 Y291* probably null Het
Slc45a3 T C 1: 131,981,547 I494T possibly damaging Het
Slc6a21 C A 7: 45,280,111 Y76* probably null Het
Slfn14 T A 11: 83,276,272 I806L possibly damaging Het
Slfn4 T A 11: 83,187,018 S211T probably benign Het
Sptbn4 A G 7: 27,372,152 V1624A probably damaging Het
Sugp1 T A 8: 70,071,184 M567K probably damaging Het
Tmem121 A T 12: 113,188,728 M189L probably benign Het
Tmem201 A G 4: 149,722,270 S444P probably damaging Het
Tmem63a T C 1: 180,973,186 V744A probably benign Het
Tnrc18 G A 5: 142,731,625 S2358F unknown Het
Ubash3b A G 9: 41,018,109 V404A probably benign Het
Unc13c A T 9: 73,749,539 C1127S probably damaging Het
Unc5a T C 13: 54,997,229 V253A probably benign Het
Vmn1r-ps123 C T 13: 22,996,365 noncoding transcript Het
Wdr74 A G 19: 8,739,485 E253G possibly damaging Het
Wwox T C 8: 114,448,248 Y107H probably damaging Het
Zdhhc22 A T 12: 86,988,238 Y147N probably damaging Het
Zfp131 T C 13: 119,788,955 H44R possibly damaging Het
Zfp235 A G 7: 24,140,959 T268A probably benign Het
Zfp280d T C 9: 72,298,858 probably benign Het
Zfp358 T C 8: 3,496,170 S251P probably damaging Het
Other mutations in Il16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Il16 APN 7 83652458 missense probably benign 0.02
IGL01743:Il16 APN 7 83652299 missense probably benign 0.00
IGL01770:Il16 APN 7 83673026 splice site probably benign
IGL02025:Il16 APN 7 83652848 missense probably damaging 1.00
IGL02317:Il16 APN 7 83666889 missense probably damaging 1.00
IGL02412:Il16 APN 7 83652691 missense probably benign 0.03
IGL02550:Il16 APN 7 83674496 missense possibly damaging 0.90
IGL02568:Il16 APN 7 83661276 missense probably damaging 1.00
IGL02578:Il16 APN 7 83677986 critical splice donor site probably null
IGL02815:Il16 APN 7 83651041 missense probably damaging 0.98
IGL03157:Il16 APN 7 83722403 missense probably damaging 1.00
IGL03161:Il16 APN 7 83722499 missense probably damaging 1.00
IGL03188:Il16 APN 7 83688163 missense probably benign 0.00
IGL03213:Il16 APN 7 83646500 missense probably damaging 1.00
IGL03274:Il16 APN 7 83661234 missense probably damaging 1.00
R0201:Il16 UTSW 7 83722308 missense probably damaging 0.99
R0309:Il16 UTSW 7 83722554 missense probably damaging 1.00
R0597:Il16 UTSW 7 83677975 splice site probably benign
R0942:Il16 UTSW 7 83663141 missense probably benign 0.01
R1018:Il16 UTSW 7 83674538 missense probably damaging 1.00
R1434:Il16 UTSW 7 83655312 missense probably benign
R1715:Il16 UTSW 7 83648728 missense probably benign 0.01
R2179:Il16 UTSW 7 83688079 splice site probably null
R2520:Il16 UTSW 7 83651994 missense probably benign 0.03
R3425:Il16 UTSW 7 83644040 missense probably damaging 1.00
R3761:Il16 UTSW 7 83650885 missense possibly damaging 0.96
R3943:Il16 UTSW 7 83652015 missense probably damaging 0.97
R4470:Il16 UTSW 7 83650838 intron probably benign
R4530:Il16 UTSW 7 83681310 intron probably benign
R4583:Il16 UTSW 7 83682899 missense probably damaging 1.00
R4777:Il16 UTSW 7 83650896 missense probably benign 0.14
R4874:Il16 UTSW 7 83660945 missense possibly damaging 0.56
R5677:Il16 UTSW 7 83674553 missense probably damaging 1.00
R5686:Il16 UTSW 7 83648728 missense probably benign 0.36
R5920:Il16 UTSW 7 83652344 missense probably benign 0.03
R6115:Il16 UTSW 7 83652567 nonsense probably null
R6459:Il16 UTSW 7 83722321 missense probably damaging 1.00
R6459:Il16 UTSW 7 83722328 missense probably damaging 1.00
R6601:Il16 UTSW 7 83722469 missense probably damaging 1.00
R6616:Il16 UTSW 7 83646476 missense probably benign 0.37
R6642:Il16 UTSW 7 83688127 missense probably benign 0.03
R6721:Il16 UTSW 7 83663062 critical splice donor site probably null
R7009:Il16 UTSW 7 83646388 missense probably benign
R7144:Il16 UTSW 7 83646451 missense probably damaging 0.97
R7346:Il16 UTSW 7 83644041 missense probably damaging 1.00
R7403:Il16 UTSW 7 83670135 missense probably damaging 1.00
R7499:Il16 UTSW 7 83674494 missense not run
Predicted Primers PCR Primer
(F):5'- TGCTAGCAAACCTCATTCTGTG -3'
(R):5'- ACTCTTTTCCAGCAAGCCAAG -3'

Sequencing Primer
(F):5'- CATATGATAGAGGCCTGGGTAGCTC -3'
(R):5'- CTTTTCCAGCAAGCCAAGAAGGG -3'
Posted On2016-03-17