Incidental Mutation 'R4876:Mybpc1'
ID376895
Institutional Source Beutler Lab
Gene Symbol Mybpc1
Ensembl Gene ENSMUSG00000020061
Gene Namemyosin binding protein C, slow-type
Synonyms8030451F13Rik, Slow-type C-protein
MMRRC Submission 042485-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.817) question?
Stock #R4876 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location88518279-88605152 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88536424 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 781 (N781K)
Ref Sequence ENSEMBL: ENSMUSP00000112615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119185] [ENSMUST00000121629]
Predicted Effect probably benign
Transcript: ENSMUST00000119185
AA Change: N767K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112699
Gene: ENSMUSG00000020061
AA Change: N767K

DomainStartEndE-ValueType
IG 51 147 1.96e-6 SMART
low complexity region 221 233 N/A INTRINSIC
IG 246 325 4.53e-2 SMART
IG 335 416 1.13e-2 SMART
IG 426 506 6.97e-3 SMART
IG 519 604 2.83e-3 SMART
FN3 607 690 4.28e-10 SMART
FN3 705 788 1.49e-9 SMART
low complexity region 800 812 N/A INTRINSIC
IG 815 898 9.06e-2 SMART
FN3 901 983 2.06e-12 SMART
IGc2 1028 1095 1.88e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121629
AA Change: N781K

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000112615
Gene: ENSMUSG00000020061
AA Change: N781K

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
IG 65 161 1.96e-6 SMART
low complexity region 235 247 N/A INTRINSIC
IG 260 339 4.53e-2 SMART
IG 349 430 1.13e-2 SMART
IG 440 520 6.97e-3 SMART
IG 533 618 2.83e-3 SMART
FN3 621 704 4.28e-10 SMART
FN3 719 802 1.49e-9 SMART
low complexity region 814 826 N/A INTRINSIC
IG 829 912 9.06e-2 SMART
FN3 915 997 2.06e-12 SMART
IGc2 1042 1109 1.88e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148205
Predicted Effect unknown
Transcript: ENSMUST00000153964
AA Change: N19K
SMART Domains Protein: ENSMUSP00000122472
Gene: ENSMUSG00000020061
AA Change: N19K

DomainStartEndE-ValueType
PDB:2YUW|A 2 52 2e-25 PDB
low complexity region 53 65 N/A INTRINSIC
IG 68 151 9.06e-2 SMART
FN3 154 236 2.06e-12 SMART
IGc2 281 348 1.88e-8 SMART
Predicted Effect unknown
Transcript: ENSMUST00000156573
AA Change: N424K
SMART Domains Protein: ENSMUSP00000119024
Gene: ENSMUSG00000020061
AA Change: N424K

DomainStartEndE-ValueType
PDB:1X44|A 2 58 1e-26 PDB
IG 66 146 6.97e-3 SMART
IG 159 244 2.83e-3 SMART
FN3 247 330 4.28e-10 SMART
FN3 345 446 1.6e-9 SMART
low complexity region 458 470 N/A INTRINSIC
IG 473 556 9.06e-2 SMART
FN3 559 617 8.17e0 SMART
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin-binding protein C family. Myosin-binding protein C family members are myosin-associated proteins found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The encoded protein is the slow skeletal muscle isoform of myosin-binding protein C and plays an important role in muscle contraction by recruiting muscle-type creatine kinase to myosin filaments. Mutations in this gene are associated with distal arthrogryposis type I. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik C T 9: 94,537,577 R100H probably damaging Het
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
9530053A07Rik A T 7: 28,142,800 probably benign Het
A630001G21Rik C T 1: 85,719,040 V167M probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano4 A G 10: 89,112,835 F138L probably damaging Het
Aoc1 T C 6: 48,906,747 V519A possibly damaging Het
Arhgef37 A T 18: 61,498,239 Y558* probably null Het
Atxn3 T A 12: 101,948,379 S29C probably damaging Het
Bbs2 T C 8: 94,070,160 probably benign Het
BC052040 A C 2: 115,670,058 H159P probably damaging Het
Bicral A T 17: 46,825,576 I236N probably damaging Het
Cabcoco1 A G 10: 68,541,769 V30A probably benign Het
Cap2 A G 13: 46,531,021 M1V probably null Het
Ccdc153 T C 9: 44,241,008 M1T probably null Het
Ccnf A T 17: 24,230,337 V489D probably damaging Het
Cntnap3 T C 13: 64,787,706 T448A probably benign Het
Cpa4 G A 6: 30,590,815 D371N probably benign Het
Csl T A 10: 99,758,540 Y221F possibly damaging Het
Dalrd3 T C 9: 108,571,436 probably benign Het
Dennd4a T A 9: 64,896,590 N1070K probably benign Het
Dmwd A T 7: 19,080,547 D374V probably damaging Het
Eea1 G T 10: 95,995,613 A189S probably benign Het
Fasn A G 11: 120,812,312 V1629A probably damaging Het
Fndc1 T C 17: 7,771,639 D1075G unknown Het
Fsip2 A G 2: 82,974,858 N507S possibly damaging Het
Gabra5 T G 7: 57,413,665 E337A probably damaging Het
Gsg1l A G 7: 125,891,669 Y288H probably benign Het
H2-M11 A T 17: 36,547,509 D65V probably benign Het
Hmgxb3 A T 18: 61,146,534 C736S possibly damaging Het
Hsd3b3 A T 3: 98,742,644 I121N probably damaging Het
Ikbke GCC G 1: 131,275,267 probably null Het
Il16 A C 7: 83,673,094 S338A probably benign Het
Itpr1 G A 6: 108,482,906 A2054T probably damaging Het
Lamp3 T A 16: 19,655,470 I385F probably damaging Het
Limch1 G A 5: 66,881,927 V66I possibly damaging Het
Lmod2 A G 6: 24,604,279 R418G probably benign Het
Ly6g6c A T 17: 35,069,440 D96V probably damaging Het
Map2k2 G A 10: 81,115,113 V131M probably damaging Het
Mapk9 T C 11: 49,854,325 V22A probably damaging Het
Mettl2 T C 11: 105,129,068 I177T probably damaging Het
Mob4 C T 1: 55,152,836 probably benign Het
Myom1 A G 17: 71,077,410 T707A probably damaging Het
Ncam2 G A 16: 81,490,346 A383T probably benign Het
Nomo1 T C 7: 46,066,491 S761P probably damaging Het
Nsd3 T A 8: 25,691,134 S921T possibly damaging Het
Olfr268-ps1 C G 2: 111,844,695 noncoding transcript Het
Olfr934 A T 9: 38,982,626 C139* probably null Het
Olfr985 C T 9: 40,127,218 V248I probably damaging Het
Omp A T 7: 98,145,026 D131E probably benign Het
Pard3 T C 8: 127,561,469 probably benign Het
Parg A G 14: 32,271,668 T286A probably damaging Het
Parp1 T A 1: 180,569,035 M1K probably null Het
Pclo T A 5: 14,811,680 S4882R unknown Het
Pcnx2 C T 8: 125,772,108 E1551K probably damaging Het
Pcyox1l A G 18: 61,699,494 Y161H probably damaging Het
Pdzd8 A T 19: 59,300,804 C721* probably null Het
Piwil4 T C 9: 14,740,465 D90G probably benign Het
Plxdc2 T A 2: 16,703,318 C306S probably damaging Het
Plxna2 T A 1: 194,643,775 F6I probably benign Het
Prkaa1 T C 15: 5,174,405 M265T probably benign Het
Prrc2b T C 2: 32,214,200 V1230A probably benign Het
Rfx2 T C 17: 56,784,706 E329G probably benign Het
Scg2 T C 1: 79,435,919 I322M probably damaging Het
Scly T A 1: 91,320,128 N399K probably damaging Het
Sec23b T A 2: 144,586,361 probably null Het
Sephs2 A T 7: 127,273,047 Y291* probably null Het
Slc45a3 T C 1: 131,981,547 I494T possibly damaging Het
Slc6a21 C A 7: 45,280,111 Y76* probably null Het
Slfn14 T A 11: 83,276,272 I806L possibly damaging Het
Slfn4 T A 11: 83,187,018 S211T probably benign Het
Sptbn4 A G 7: 27,372,152 V1624A probably damaging Het
Sugp1 T A 8: 70,071,184 M567K probably damaging Het
Tmem121 A T 12: 113,188,728 M189L probably benign Het
Tmem201 A G 4: 149,722,270 S444P probably damaging Het
Tmem63a T C 1: 180,973,186 V744A probably benign Het
Tnrc18 G A 5: 142,731,625 S2358F unknown Het
Ubash3b A G 9: 41,018,109 V404A probably benign Het
Unc13c A T 9: 73,749,539 C1127S probably damaging Het
Unc5a T C 13: 54,997,229 V253A probably benign Het
Vmn1r-ps123 C T 13: 22,996,365 noncoding transcript Het
Wdr74 A G 19: 8,739,485 E253G possibly damaging Het
Wwox T C 8: 114,448,248 Y107H probably damaging Het
Zdhhc22 A T 12: 86,988,238 Y147N probably damaging Het
Zfp131 T C 13: 119,788,955 H44R possibly damaging Het
Zfp235 A G 7: 24,140,959 T268A probably benign Het
Zfp280d T C 9: 72,298,858 probably benign Het
Zfp358 T C 8: 3,496,170 S251P probably damaging Het
Other mutations in Mybpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Mybpc1 APN 10 88549262 missense probably damaging 0.98
IGL00577:Mybpc1 APN 10 88536384 missense probably damaging 1.00
IGL00703:Mybpc1 APN 10 88525108 splice site probably null
IGL00964:Mybpc1 APN 10 88555742 critical splice acceptor site probably null
IGL01738:Mybpc1 APN 10 88570645 missense probably damaging 1.00
IGL01978:Mybpc1 APN 10 88531770 missense probably damaging 1.00
IGL02255:Mybpc1 APN 10 88536428 missense probably damaging 1.00
IGL02997:Mybpc1 APN 10 88526373 missense probably damaging 1.00
R0098:Mybpc1 UTSW 10 88529564 missense probably benign 0.02
R0240:Mybpc1 UTSW 10 88555738 missense possibly damaging 0.59
R0240:Mybpc1 UTSW 10 88555738 missense possibly damaging 0.59
R0449:Mybpc1 UTSW 10 88540960 missense probably damaging 1.00
R0879:Mybpc1 UTSW 10 88571516 splice site probably benign
R1321:Mybpc1 UTSW 10 88529541 missense possibly damaging 0.85
R1321:Mybpc1 UTSW 10 88570601 missense probably damaging 1.00
R1562:Mybpc1 UTSW 10 88553331 missense probably damaging 1.00
R1783:Mybpc1 UTSW 10 88570568 missense probably damaging 1.00
R1803:Mybpc1 UTSW 10 88553295 missense possibly damaging 0.65
R1962:Mybpc1 UTSW 10 88548826 missense probably damaging 1.00
R1972:Mybpc1 UTSW 10 88551542 missense probably benign 0.00
R2006:Mybpc1 UTSW 10 88546059 missense probably damaging 0.99
R2125:Mybpc1 UTSW 10 88573437 nonsense probably null
R2129:Mybpc1 UTSW 10 88551452 missense probably damaging 1.00
R2163:Mybpc1 UTSW 10 88540942 splice site probably benign
R2200:Mybpc1 UTSW 10 88555695 missense probably damaging 1.00
R2219:Mybpc1 UTSW 10 88555678 missense probably damaging 1.00
R2270:Mybpc1 UTSW 10 88551407 missense probably benign 0.01
R2961:Mybpc1 UTSW 10 88531779 missense probably damaging 1.00
R3767:Mybpc1 UTSW 10 88570659 splice site probably null
R4032:Mybpc1 UTSW 10 88529564 missense probably benign 0.02
R4226:Mybpc1 UTSW 10 88573525 nonsense probably null
R4821:Mybpc1 UTSW 10 88548865 missense probably damaging 0.98
R4876:Mybpc1 UTSW 10 88522991 missense probably benign
R4878:Mybpc1 UTSW 10 88551430 missense possibly damaging 0.95
R4910:Mybpc1 UTSW 10 88555724 nonsense probably null
R4913:Mybpc1 UTSW 10 88553254 critical splice donor site probably null
R4964:Mybpc1 UTSW 10 88555663 missense probably benign 0.31
R5023:Mybpc1 UTSW 10 88543774 missense probably damaging 1.00
R5098:Mybpc1 UTSW 10 88546064 missense probably damaging 1.00
R5196:Mybpc1 UTSW 10 88536351 missense probably damaging 0.97
R5344:Mybpc1 UTSW 10 88570568 missense probably damaging 1.00
R5399:Mybpc1 UTSW 10 88523014 missense probably damaging 1.00
R5538:Mybpc1 UTSW 10 88546029 missense possibly damaging 0.89
R5808:Mybpc1 UTSW 10 88570566 missense possibly damaging 0.83
R5970:Mybpc1 UTSW 10 88542456 missense probably damaging 1.00
R6324:Mybpc1 UTSW 10 88568619 missense possibly damaging 0.56
R6433:Mybpc1 UTSW 10 88560355 missense probably damaging 1.00
R6441:Mybpc1 UTSW 10 88553277 missense probably benign 0.09
R6648:Mybpc1 UTSW 10 88522999 missense probably damaging 0.96
R6844:Mybpc1 UTSW 10 88536381 missense possibly damaging 0.50
R6931:Mybpc1 UTSW 10 88542330 nonsense probably null
R6972:Mybpc1 UTSW 10 88560361 missense possibly damaging 0.50
R6973:Mybpc1 UTSW 10 88560361 missense possibly damaging 0.50
R6978:Mybpc1 UTSW 10 88523024 missense probably damaging 1.00
R7007:Mybpc1 UTSW 10 88553412 missense probably damaging 1.00
R7019:Mybpc1 UTSW 10 88543719 missense probably damaging 1.00
R7407:Mybpc1 UTSW 10 88549347 missense probably damaging 0.99
R7442:Mybpc1 UTSW 10 88526293 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTAGGATGATGCCCATTTGG -3'
(R):5'- ACCCTGTTCTTTCCAAAGGATC -3'

Sequencing Primer
(F):5'- TTTGAGAGGGATCCACTAGCC -3'
(R):5'- TGTTCTTTCCAAAGGATCTAAGTATG -3'
Posted On2016-03-17