Incidental Mutation 'R4876:Myom1'
ID376923
Institutional Source Beutler Lab
Gene Symbol Myom1
Ensembl Gene ENSMUSG00000024049
Gene Namemyomesin 1
Synonymsskelemin, D430047A17Rik
MMRRC Submission 042485-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R4876 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location71019521-71126856 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71077410 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 707 (T707A)
Ref Sequence ENSEMBL: ENSMUSP00000136266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024847
AA Change: T707A

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049
AA Change: T707A

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000073211
AA Change: T707A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049
AA Change: T707A

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
low complexity region 857 870 N/A INTRINSIC
FN3 916 1002 4.99e-11 SMART
FN3 1021 1106 2.04e-16 SMART
IG 1123 1208 3.1e0 SMART
IG_like 1231 1317 1.34e1 SMART
IG_like 1351 1417 4.79e0 SMART
IG_like 1454 1531 1.54e2 SMART
IGc2 1567 1635 2.05e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179759
AA Change: T707A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049
AA Change: T707A

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik C T 9: 94,537,577 R100H probably damaging Het
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
9530053A07Rik A T 7: 28,142,800 probably benign Het
A630001G21Rik C T 1: 85,719,040 V167M probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano4 A G 10: 89,112,835 F138L probably damaging Het
Aoc1 T C 6: 48,906,747 V519A possibly damaging Het
Arhgef37 A T 18: 61,498,239 Y558* probably null Het
Atxn3 T A 12: 101,948,379 S29C probably damaging Het
Bbs2 T C 8: 94,070,160 probably benign Het
BC052040 A C 2: 115,670,058 H159P probably damaging Het
Bicral A T 17: 46,825,576 I236N probably damaging Het
Cabcoco1 A G 10: 68,541,769 V30A probably benign Het
Cap2 A G 13: 46,531,021 M1V probably null Het
Ccdc153 T C 9: 44,241,008 M1T probably null Het
Ccnf A T 17: 24,230,337 V489D probably damaging Het
Cntnap3 T C 13: 64,787,706 T448A probably benign Het
Cpa4 G A 6: 30,590,815 D371N probably benign Het
Csl T A 10: 99,758,540 Y221F possibly damaging Het
Dalrd3 T C 9: 108,571,436 probably benign Het
Dennd4a T A 9: 64,896,590 N1070K probably benign Het
Dmwd A T 7: 19,080,547 D374V probably damaging Het
Eea1 G T 10: 95,995,613 A189S probably benign Het
Fasn A G 11: 120,812,312 V1629A probably damaging Het
Fndc1 T C 17: 7,771,639 D1075G unknown Het
Fsip2 A G 2: 82,974,858 N507S possibly damaging Het
Gabra5 T G 7: 57,413,665 E337A probably damaging Het
Gsg1l A G 7: 125,891,669 Y288H probably benign Het
H2-M11 A T 17: 36,547,509 D65V probably benign Het
Hmgxb3 A T 18: 61,146,534 C736S possibly damaging Het
Hsd3b3 A T 3: 98,742,644 I121N probably damaging Het
Ikbke GCC G 1: 131,275,267 probably null Het
Il16 A C 7: 83,673,094 S338A probably benign Het
Itpr1 G A 6: 108,482,906 A2054T probably damaging Het
Lamp3 T A 16: 19,655,470 I385F probably damaging Het
Limch1 G A 5: 66,881,927 V66I possibly damaging Het
Lmod2 A G 6: 24,604,279 R418G probably benign Het
Ly6g6c A T 17: 35,069,440 D96V probably damaging Het
Map2k2 G A 10: 81,115,113 V131M probably damaging Het
Mapk9 T C 11: 49,854,325 V22A probably damaging Het
Mettl2 T C 11: 105,129,068 I177T probably damaging Het
Mob4 C T 1: 55,152,836 probably benign Het
Mybpc1 T C 10: 88,522,991 I1113V probably benign Het
Mybpc1 A T 10: 88,536,424 N781K probably benign Het
Ncam2 G A 16: 81,490,346 A383T probably benign Het
Nomo1 T C 7: 46,066,491 S761P probably damaging Het
Nsd3 T A 8: 25,691,134 S921T possibly damaging Het
Olfr268-ps1 C G 2: 111,844,695 noncoding transcript Het
Olfr934 A T 9: 38,982,626 C139* probably null Het
Olfr985 C T 9: 40,127,218 V248I probably damaging Het
Omp A T 7: 98,145,026 D131E probably benign Het
Pard3 T C 8: 127,561,469 probably benign Het
Parg A G 14: 32,271,668 T286A probably damaging Het
Parp1 T A 1: 180,569,035 M1K probably null Het
Pclo T A 5: 14,811,680 S4882R unknown Het
Pcnx2 C T 8: 125,772,108 E1551K probably damaging Het
Pcyox1l A G 18: 61,699,494 Y161H probably damaging Het
Pdzd8 A T 19: 59,300,804 C721* probably null Het
Piwil4 T C 9: 14,740,465 D90G probably benign Het
Plxdc2 T A 2: 16,703,318 C306S probably damaging Het
Plxna2 T A 1: 194,643,775 F6I probably benign Het
Prkaa1 T C 15: 5,174,405 M265T probably benign Het
Prrc2b T C 2: 32,214,200 V1230A probably benign Het
Rfx2 T C 17: 56,784,706 E329G probably benign Het
Scg2 T C 1: 79,435,919 I322M probably damaging Het
Scly T A 1: 91,320,128 N399K probably damaging Het
Sec23b T A 2: 144,586,361 probably null Het
Sephs2 A T 7: 127,273,047 Y291* probably null Het
Slc45a3 T C 1: 131,981,547 I494T possibly damaging Het
Slc6a21 C A 7: 45,280,111 Y76* probably null Het
Slfn14 T A 11: 83,276,272 I806L possibly damaging Het
Slfn4 T A 11: 83,187,018 S211T probably benign Het
Sptbn4 A G 7: 27,372,152 V1624A probably damaging Het
Sugp1 T A 8: 70,071,184 M567K probably damaging Het
Tmem121 A T 12: 113,188,728 M189L probably benign Het
Tmem201 A G 4: 149,722,270 S444P probably damaging Het
Tmem63a T C 1: 180,973,186 V744A probably benign Het
Tnrc18 G A 5: 142,731,625 S2358F unknown Het
Ubash3b A G 9: 41,018,109 V404A probably benign Het
Unc13c A T 9: 73,749,539 C1127S probably damaging Het
Unc5a T C 13: 54,997,229 V253A probably benign Het
Vmn1r-ps123 C T 13: 22,996,365 noncoding transcript Het
Wdr74 A G 19: 8,739,485 E253G possibly damaging Het
Wwox T C 8: 114,448,248 Y107H probably damaging Het
Zdhhc22 A T 12: 86,988,238 Y147N probably damaging Het
Zfp131 T C 13: 119,788,955 H44R possibly damaging Het
Zfp235 A G 7: 24,140,959 T268A probably benign Het
Zfp280d T C 9: 72,298,858 probably benign Het
Zfp358 T C 8: 3,496,170 S251P probably damaging Het
Other mutations in Myom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom1 APN 17 71126098 missense probably damaging 1.00
IGL00845:Myom1 APN 17 71084429 missense probably damaging 1.00
IGL00904:Myom1 APN 17 71099949 splice site probably benign
IGL00928:Myom1 APN 17 71089913 missense probably damaging 1.00
IGL01025:Myom1 APN 17 71077917 missense probably damaging 1.00
IGL01548:Myom1 APN 17 71101220 splice site probably benign
IGL01588:Myom1 APN 17 71117437 missense possibly damaging 0.94
IGL01614:Myom1 APN 17 71126178 missense possibly damaging 0.46
IGL01618:Myom1 APN 17 71099993 missense possibly damaging 0.87
IGL01619:Myom1 APN 17 71044476 splice site probably benign
IGL01766:Myom1 APN 17 71077288 missense probably damaging 1.00
IGL02105:Myom1 APN 17 71047716 splice site probably benign
IGL02122:Myom1 APN 17 71092137 missense probably damaging 1.00
IGL02184:Myom1 APN 17 71072137 missense possibly damaging 0.93
IGL02260:Myom1 APN 17 71108315 nonsense probably null
IGL02486:Myom1 APN 17 71099944 splice site probably benign
IGL02501:Myom1 APN 17 71072081 critical splice acceptor site probably null
IGL02642:Myom1 APN 17 71101098 missense possibly damaging 0.90
IGL02677:Myom1 APN 17 71084349 missense probably damaging 1.00
IGL02719:Myom1 APN 17 71106354 splice site probably benign
IGL02945:Myom1 APN 17 71092093 splice site probably benign
IGL03086:Myom1 APN 17 71108671 missense probably damaging 1.00
IGL03218:Myom1 APN 17 71084316 missense possibly damaging 0.46
R0107:Myom1 UTSW 17 71077365 missense probably damaging 1.00
R0130:Myom1 UTSW 17 71045755 missense probably damaging 0.98
R0133:Myom1 UTSW 17 71047787 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0352:Myom1 UTSW 17 71045749 missense possibly damaging 0.72
R0396:Myom1 UTSW 17 71034693 missense probably damaging 1.00
R0496:Myom1 UTSW 17 71084306 missense probably damaging 1.00
R0506:Myom1 UTSW 17 71092220 splice site probably benign
R0511:Myom1 UTSW 17 71084317 missense probably benign 0.22
R0600:Myom1 UTSW 17 71120648 missense possibly damaging 0.48
R0699:Myom1 UTSW 17 71067313 missense probably damaging 0.98
R0791:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0792:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0963:Myom1 UTSW 17 71077767 missense possibly damaging 0.74
R1324:Myom1 UTSW 17 71052719 missense probably damaging 0.98
R2102:Myom1 UTSW 17 71101029 missense probably damaging 1.00
R2158:Myom1 UTSW 17 71064597 missense possibly damaging 0.83
R2336:Myom1 UTSW 17 71023194 missense possibly damaging 0.53
R2351:Myom1 UTSW 17 71034579 missense probably damaging 0.98
R2442:Myom1 UTSW 17 71110735 missense probably damaging 1.00
R2483:Myom1 UTSW 17 71077812 missense probably damaging 1.00
R2892:Myom1 UTSW 17 71034653 missense probably damaging 1.00
R2897:Myom1 UTSW 17 71101220 splice site probably benign
R3440:Myom1 UTSW 17 71045663 intron probably null
R3842:Myom1 UTSW 17 71045624 missense probably damaging 1.00
R4249:Myom1 UTSW 17 71092140 missense probably damaging 1.00
R4329:Myom1 UTSW 17 71036353 missense probably damaging 1.00
R4594:Myom1 UTSW 17 71100074 missense possibly damaging 0.73
R4873:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4875:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R5171:Myom1 UTSW 17 71099972 missense possibly damaging 0.94
R5540:Myom1 UTSW 17 71109787 missense probably damaging 1.00
R5882:Myom1 UTSW 17 71110722 missense probably damaging 1.00
R5978:Myom1 UTSW 17 71117443 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6155:Myom1 UTSW 17 71108695 critical splice donor site probably null
R6261:Myom1 UTSW 17 71126137 missense probably damaging 1.00
R6284:Myom1 UTSW 17 71022892 nonsense probably null
R6313:Myom1 UTSW 17 71082488 missense probably benign
R6369:Myom1 UTSW 17 71101076 missense probably damaging 1.00
R6545:Myom1 UTSW 17 71082305 missense probably benign 0.00
R6738:Myom1 UTSW 17 71100398 intron probably null
R6933:Myom1 UTSW 17 71052671 missense probably damaging 1.00
X0019:Myom1 UTSW 17 71100071 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- CCAGTAATGCCAGCATTCCG -3'
(R):5'- ATTGTGCTGAAGAAGTGTCAGTTAG -3'

Sequencing Primer
(F):5'- GTAATGCCAGCATTCCGGTTGC -3'
(R):5'- ACTAAGTGGAATATCTGTGGATGC -3'
Posted On2016-03-17