Incidental Mutation 'R4887:Brca2'
ID376964
Institutional Source Beutler Lab
Gene Symbol Brca2
Ensembl Gene ENSMUSG00000041147
Gene Namebreast cancer 2, early onset
SynonymsFancd1, RAB163
MMRRC Submission 041979-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4887 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location150522630-150570329 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 150556937 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 2724 (L2724Q)
Ref Sequence ENSEMBL: ENSMUSP00000144150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044620] [ENSMUST00000202313]
Predicted Effect probably damaging
Transcript: ENSMUST00000044620
AA Change: L2724Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038576
Gene: ENSMUSG00000041147
AA Change: L2724Q

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
low complexity region 100 123 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 746 761 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
Pfam:BRCA2 982 1014 2.6e-13 PFAM
Pfam:BRCA2 1193 1225 3.9e-16 PFAM
low complexity region 1239 1252 N/A INTRINSIC
Pfam:BRCA2 1395 1425 1.4e-13 PFAM
Pfam:BRCA2 1492 1524 1.8e-13 PFAM
Pfam:BRCA2 1624 1655 8.4e-12 PFAM
Pfam:BRCA2 1925 1957 8e-15 PFAM
Pfam:BRCA2 2005 2037 1.7e-11 PFAM
Pfam:BRCA-2_helical 2402 2588 1.3e-94 PFAM
Pfam:BRCA-2_OB1 2591 2717 5.3e-44 PFAM
Tower 2752 2793 2.37e-18 SMART
Pfam:BRCA-2_OB3 2971 3104 1.5e-49 PFAM
low complexity region 3197 3208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201843
Predicted Effect probably damaging
Transcript: ENSMUST00000202313
AA Change: L2724Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144150
Gene: ENSMUSG00000041147
AA Change: L2724Q

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
low complexity region 100 123 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 746 761 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
Pfam:BRCA2 982 1014 2.6e-13 PFAM
Pfam:BRCA2 1193 1225 3.9e-16 PFAM
low complexity region 1239 1252 N/A INTRINSIC
Pfam:BRCA2 1395 1425 1.4e-13 PFAM
Pfam:BRCA2 1492 1524 1.8e-13 PFAM
Pfam:BRCA2 1624 1655 8.4e-12 PFAM
Pfam:BRCA2 1925 1957 8e-15 PFAM
Pfam:BRCA2 2005 2037 1.7e-11 PFAM
Pfam:BRCA-2_helical 2402 2588 1.3e-94 PFAM
Pfam:BRCA-2_OB1 2591 2717 5.3e-44 PFAM
Tower 2752 2793 2.37e-18 SMART
Pfam:BRCA-2_OB3 2971 3104 1.5e-49 PFAM
low complexity region 3197 3208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202837
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Inherited mutations in BRCA1 and this gene, BRCA2, confer increased lifetime risk of developing breast or ovarian cancer. Both BRCA1 and BRCA2 are involved in maintenance of genome stability, specifically the homologous recombination pathway for double-strand DNA repair. The BRCA2 protein contains several copies of a 70 aa motif called the BRC motif, and these motifs mediate binding to the RAD51 recombinase which functions in DNA repair. BRCA2 is considered a tumor suppressor gene, as tumors with BRCA2 mutations generally exhibit loss of heterozygosity (LOH) of the wild-type allele. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA2 protein survive, are small, infertile, show improper tissue differentiation and develop lymphomas and carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,876,324 I22F possibly damaging Het
2310009B15Rik A C 1: 138,852,165 Y116* probably null Het
4930548H24Rik A G 5: 31,486,252 I109V probably benign Het
Acer3 T C 7: 98,257,701 T91A possibly damaging Het
Adam12 T C 7: 134,172,821 K20E possibly damaging Het
Adamtsl3 T C 7: 82,574,614 V275A possibly damaging Het
Afg1l C T 10: 42,454,378 V98I probably benign Het
Alpk1 C T 3: 127,673,475 G1052R probably damaging Het
Anln A T 9: 22,380,188 S115T possibly damaging Het
Apob T A 12: 8,013,099 N3827K probably damaging Het
Aqr G A 2: 114,150,509 L264F probably damaging Het
Arhgap33 T C 7: 30,532,192 S123G probably damaging Het
Arvcf C T 16: 18,398,113 R333* probably null Het
Btbd11 C T 10: 85,387,378 T17M unknown Het
C2cd6 T A 1: 59,094,734 T43S probably benign Het
Cacna1h A G 17: 25,377,287 V1920A possibly damaging Het
Capsl A T 15: 9,457,772 I26F possibly damaging Het
Card10 A T 15: 78,781,524 V673E possibly damaging Het
Ccar1 A G 10: 62,753,218 S829P unknown Het
Cdc42bpa T C 1: 180,144,635 M1334T possibly damaging Het
Ceacam2 C T 7: 25,520,832 C267Y probably benign Het
Cep68 G A 11: 20,239,239 T591M probably benign Het
Chil4 T C 3: 106,204,144 K218R probably benign Het
Cldn14 G T 16: 93,919,859 T33K possibly damaging Het
Copa T A 1: 172,092,276 C140S probably benign Het
Coq6 T C 12: 84,372,296 L358P probably damaging Het
Cyfip1 C T 7: 55,872,068 P40L probably damaging Het
Dennd2a A C 6: 39,497,159 S414A probably benign Het
Dpm1 T C 2: 168,217,759 N139S probably benign Het
Dpp7 T A 2: 25,352,758 probably null Het
Ednrb T C 14: 103,820,011 I372V possibly damaging Het
Edrf1 G T 7: 133,658,610 M83I probably damaging Het
Fam135a G A 1: 24,024,253 Q1087* probably null Het
Fancg T C 4: 43,006,866 T275A probably benign Het
Fbn1 T A 2: 125,309,774 H2520L probably damaging Het
Fmn2 T C 1: 174,581,961 S587P unknown Het
Foxr2 A G X: 153,130,316 Q61R probably damaging Het
Frrs1 A G 3: 116,902,416 *124W probably null Het
Gm16432 A G 1: 178,103,949 Y478C unknown Het
Gm7535 T A 17: 17,911,071 probably benign Het
Gm884 T C 11: 103,614,872 H2090R probably benign Het
Gm996 G A 2: 25,579,747 R51C possibly damaging Het
Herc3 T C 6: 58,887,499 V706A probably damaging Het
Hist1h4a T C 13: 23,760,952 D69G probably damaging Het
Hivep3 A G 4: 120,122,934 E1723G probably damaging Het
Igsf9b A G 9: 27,322,650 I382V probably benign Het
Ints1 G T 5: 139,771,156 T467N possibly damaging Het
Iqca G A 1: 90,045,701 T783M probably damaging Het
Kng1 A G 16: 23,067,698 K131R possibly damaging Het
Krt35 T C 11: 100,093,130 Y348C probably damaging Het
Ldlrad3 A G 2: 102,113,536 C64R probably damaging Het
Lilr4b C T 10: 51,484,520 A272V possibly damaging Het
Ltn1 A T 16: 87,398,809 C1276* probably null Het
Matn1 G A 4: 130,952,114 A360T probably benign Het
Minpp1 G A 19: 32,498,384 V306I probably benign Het
Mkx G A 18: 6,992,904 R127W probably damaging Het
Mrpl48 G T 7: 100,546,409 probably benign Het
Ms4a2 A G 19: 11,618,429 L166S possibly damaging Het
Mtus2 T A 5: 148,077,103 Y235* probably null Het
Myh4 G T 11: 67,241,054 W113C probably damaging Het
Nav2 T A 7: 49,548,434 C1270* probably null Het
Ncoa5 A G 2: 165,002,150 L111P probably damaging Het
Nup107 T C 10: 117,770,478 Y453C probably damaging Het
Oca2 C T 7: 56,330,358 Q604* probably null Het
Olfr116 A T 17: 37,623,891 V248D probably damaging Het
Olfr1339 A C 4: 118,734,688 H53P probably benign Het
Olfr482 T A 7: 108,095,096 N158I probably benign Het
Olfr525 T C 7: 140,323,101 M134T probably benign Het
Olfr952 T C 9: 39,426,235 T279A possibly damaging Het
Pde3a G T 6: 141,470,942 G514V possibly damaging Het
Pik3cb A T 9: 99,101,328 C76S probably damaging Het
Plk1 T C 7: 122,168,605 V411A probably damaging Het
Pole C T 5: 110,324,753 P1600L probably damaging Het
Prr36 T C 8: 4,210,881 T979A probably benign Het
Rdh7 T A 10: 127,885,721 T229S probably benign Het
Rnpepl1 A T 1: 92,915,113 T140S probably damaging Het
Rps6kc1 A T 1: 190,798,694 S947T probably benign Het
Rtl1 A G 12: 109,591,704 F1234L probably damaging Het
Sdc1 G A 12: 8,791,708 M279I probably damaging Het
Siae T C 9: 37,627,800 L169P possibly damaging Het
Slc22a22 C T 15: 57,249,752 V364I probably benign Het
Sltm G T 9: 70,588,978 V932F probably damaging Het
Smad1 A G 8: 79,349,752 L279P probably damaging Het
Spag17 G T 3: 100,050,831 G935V probably damaging Het
Srgap3 A G 6: 112,746,934 S546P probably damaging Het
Stxbp5 T C 10: 9,809,100 I519V probably benign Het
Syt16 A T 12: 74,129,386 I10F probably damaging Het
Trim43b C G 9: 89,091,312 G123R probably damaging Het
Ubr3 T C 2: 70,013,131 Y1572H probably damaging Het
Umodl1 G A 17: 31,008,665 R1324H probably benign Het
Vmn2r44 A T 7: 8,377,986 W303R probably benign Het
Wdr93 T C 7: 79,785,774 Y684H probably damaging Het
Wnk2 G A 13: 49,071,002 R268C probably damaging Het
Zfp438 C T 18: 5,213,776 C394Y possibly damaging Het
Other mutations in Brca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Brca2 APN 5 150539898 missense probably benign 0.18
IGL00392:Brca2 APN 5 150541240 missense probably benign 0.02
IGL00557:Brca2 APN 5 150560538 missense probably benign
IGL00798:Brca2 APN 5 150539463 missense probably benign 0.30
IGL00933:Brca2 APN 5 150542404 missense probably benign 0.04
IGL00964:Brca2 APN 5 150532310 missense probably damaging 1.00
IGL01152:Brca2 APN 5 150542390 missense probably damaging 0.99
IGL01577:Brca2 APN 5 150541620 nonsense probably null
IGL01585:Brca2 APN 5 150539516 missense possibly damaging 0.76
IGL01732:Brca2 APN 5 150542387 missense probably benign 0.13
IGL01809:Brca2 APN 5 150531061 splice site probably null
IGL01911:Brca2 APN 5 150567613 missense probably damaging 0.96
IGL02113:Brca2 APN 5 150540979 missense possibly damaging 0.95
IGL02313:Brca2 APN 5 150538661 missense probably damaging 1.00
IGL02342:Brca2 APN 5 150542824 missense possibly damaging 0.94
IGL02508:Brca2 APN 5 150543308 missense possibly damaging 0.85
IGL02532:Brca2 APN 5 150550862 missense probably damaging 1.00
IGL02646:Brca2 APN 5 150560790 missense possibly damaging 0.89
IGL02738:Brca2 APN 5 150567035 missense probably damaging 1.00
IGL02833:Brca2 APN 5 150541790 missense possibly damaging 0.83
IGL02871:Brca2 APN 5 150542552 missense probably benign 0.13
IGL02995:Brca2 APN 5 150529488 missense probably damaging 1.00
IGL03105:Brca2 APN 5 150560485 missense probably benign 0.02
R0219:Brca2 UTSW 5 150523175 splice site probably benign
R0416:Brca2 UTSW 5 150569392 missense possibly damaging 0.93
R0441:Brca2 UTSW 5 150541857 missense probably damaging 0.96
R0548:Brca2 UTSW 5 150544935 missense probably damaging 0.96
R0745:Brca2 UTSW 5 150544882 splice site probably benign
R0799:Brca2 UTSW 5 150560193 missense probably damaging 0.99
R1165:Brca2 UTSW 5 150542747 missense probably damaging 0.98
R1247:Brca2 UTSW 5 150541274 missense probably damaging 1.00
R1403:Brca2 UTSW 5 150542649 missense probably benign 0.22
R1403:Brca2 UTSW 5 150542649 missense probably benign 0.22
R1444:Brca2 UTSW 5 150542450 missense probably benign
R1466:Brca2 UTSW 5 150552258 missense probably damaging 0.99
R1466:Brca2 UTSW 5 150552258 missense probably damaging 0.99
R1584:Brca2 UTSW 5 150552258 missense probably damaging 0.99
R1599:Brca2 UTSW 5 150548713 nonsense probably null
R1600:Brca2 UTSW 5 150560830 splice site probably benign
R1822:Brca2 UTSW 5 150540198 missense probably benign 0.06
R1824:Brca2 UTSW 5 150536922 missense possibly damaging 0.94
R2037:Brca2 UTSW 5 150540669 missense probably benign
R2131:Brca2 UTSW 5 150557129 missense probably damaging 1.00
R2203:Brca2 UTSW 5 150539502 missense possibly damaging 0.58
R2208:Brca2 UTSW 5 150532344 missense probably damaging 0.96
R2293:Brca2 UTSW 5 150560534 missense possibly damaging 0.86
R2517:Brca2 UTSW 5 150539672 missense probably benign 0.04
R2566:Brca2 UTSW 5 150541762 missense probably benign 0.03
R3422:Brca2 UTSW 5 150543121 missense possibly damaging 0.91
R3917:Brca2 UTSW 5 150540827 missense probably damaging 0.96
R3946:Brca2 UTSW 5 150536704 missense probably damaging 0.96
R4176:Brca2 UTSW 5 150539633 nonsense probably null
R4255:Brca2 UTSW 5 150541169 missense possibly damaging 0.92
R4450:Brca2 UTSW 5 150536053 missense probably damaging 0.96
R4603:Brca2 UTSW 5 150536165 missense possibly damaging 0.86
R4681:Brca2 UTSW 5 150552398 splice site probably null
R4755:Brca2 UTSW 5 150559987 intron probably null
R4762:Brca2 UTSW 5 150531116 missense probably benign 0.00
R4824:Brca2 UTSW 5 150539735 missense probably damaging 1.00
R5020:Brca2 UTSW 5 150560436 missense probably damaging 1.00
R5159:Brca2 UTSW 5 150542108 missense possibly damaging 0.93
R5216:Brca2 UTSW 5 150542980 missense probably damaging 0.99
R5269:Brca2 UTSW 5 150539223 missense possibly damaging 0.75
R5274:Brca2 UTSW 5 150539689 missense probably benign 0.00
R5589:Brca2 UTSW 5 150557132 missense possibly damaging 0.67
R5619:Brca2 UTSW 5 150557114 missense probably damaging 0.96
R5641:Brca2 UTSW 5 150556899 missense probably damaging 1.00
R5686:Brca2 UTSW 5 150540904 missense probably benign 0.00
R5730:Brca2 UTSW 5 150569005 missense possibly damaging 0.85
R5763:Brca2 UTSW 5 150548006 missense possibly damaging 0.85
R5877:Brca2 UTSW 5 150543221 missense possibly damaging 0.53
R5893:Brca2 UTSW 5 150569138 missense probably benign 0.02
R5900:Brca2 UTSW 5 150541132 missense probably benign 0.01
R5926:Brca2 UTSW 5 150534622 missense probably benign 0.07
R5966:Brca2 UTSW 5 150543251 missense probably damaging 0.99
R6025:Brca2 UTSW 5 150541575 frame shift probably null
R6062:Brca2 UTSW 5 150556889 missense probably damaging 0.96
R6141:Brca2 UTSW 5 150540637 missense possibly damaging 0.91
R6244:Brca2 UTSW 5 150566978 missense probably benign 0.08
R6508:Brca2 UTSW 5 150536593 missense possibly damaging 0.91
R6519:Brca2 UTSW 5 150540979 missense probably damaging 0.99
R6611:Brca2 UTSW 5 150536193 missense probably damaging 0.99
R6698:Brca2 UTSW 5 150532394 missense probably damaging 1.00
R6856:Brca2 UTSW 5 150540208 missense possibly damaging 0.68
R6912:Brca2 UTSW 5 150541742 missense probably damaging 0.99
R7002:Brca2 UTSW 5 150539918 missense probably benign
R7025:Brca2 UTSW 5 150540478 missense probably benign 0.39
R7151:Brca2 UTSW 5 150541436 missense probably benign 0.12
R7202:Brca2 UTSW 5 150532354 missense probably benign 0.03
Z1088:Brca2 UTSW 5 150542763 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CATTAAAATTGCAATTAAGTCCCCTT -3'
(R):5'- TCTCCACCCACTGACAATGTAA -3'

Sequencing Primer
(F):5'- TCCAATAGCTGACTGTGAGC -3'
(R):5'- ACCTGTAAAGGGTACACTC -3'
Posted On2016-03-17