Incidental Mutation 'R4889:Cr2'
ID377178
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Namecomplement receptor 2
SynonymsC3DR, CD21, Cr-1, Cr1, CD35, Cr-2
MMRRC Submission 042494-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R4889 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location195136811-195176716 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 195176585 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 9 (V9A)
Ref Sequence ENSEMBL: ENSMUSP00000147804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
Predicted Effect probably benign
Transcript: ENSMUST00000082321
AA Change: V9A

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: V9A

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000193801
AA Change: V9A
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616
AA Change: V9A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000195120
AA Change: V9A

PolyPhen 2 Score 0.621 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: V9A

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195722
Predicted Effect possibly damaging
Transcript: ENSMUST00000210219
AA Change: V9A

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.09 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ado G C 10: 67,548,305 R157G probably benign Het
Akap12 C A 10: 4,356,535 A1115E probably damaging Het
Ankhd1 A G 18: 36,578,734 M196V probably null Het
Appl2 G A 10: 83,641,058 T34I probably damaging Het
Arhgap21 T C 2: 20,880,468 S472G probably benign Het
Asmt G T X: 170,677,029 R250L possibly damaging Het
Baz2b A T 2: 59,936,726 I870N probably damaging Het
Card11 T C 5: 140,885,945 Q667R possibly damaging Het
Cercam A G 2: 29,881,833 D555G probably damaging Het
Cop1 A T 1: 159,284,589 R284S probably damaging Het
Ctsm A G 13: 61,538,401 F106S probably damaging Het
Dhx9 A T 1: 153,481,149 L118Q probably damaging Het
Dnah5 G T 15: 28,235,792 C355F probably benign Het
Dock1 C A 7: 134,744,976 N212K probably benign Het
Efemp2 T A 19: 5,475,120 L18Q probably null Het
Flvcr1 A G 1: 191,025,567 L176P probably damaging Het
Gm16505 A T 13: 3,361,125 noncoding transcript Het
Gm6457 A T 18: 14,570,444 noncoding transcript Het
Gnptab A G 10: 88,433,913 N826S probably benign Het
Hdc T G 2: 126,594,133 N606T probably benign Het
Itga3 T C 11: 95,068,301 D113G probably benign Het
Maml3 C T 3: 51,694,510 probably benign Het
Mkrn1 A T 6: 39,420,005 probably benign Het
Myo18a T C 11: 77,832,412 V720A probably damaging Het
Nkx3-1 G A 14: 69,190,998 probably null Het
Npat T C 9: 53,562,207 I433T probably benign Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1024 C T 2: 85,904,748 C102Y possibly damaging Het
Olfr1115 A T 2: 87,252,647 I237F probably damaging Het
Olfr365 A G 2: 37,202,045 Y268C probably damaging Het
Pde6c T A 19: 38,133,151 M69K probably benign Het
Pde7b T C 10: 20,548,077 T18A probably benign Het
Plcz1 T C 6: 140,007,748 K381R probably benign Het
Ppfia4 A C 1: 134,300,514 F1095V probably damaging Het
Sfxn3 T C 19: 45,049,815 F78S probably damaging Het
Sim1 A T 10: 50,981,324 Y390F probably benign Het
Slc25a31 A G 3: 40,721,545 I174V probably benign Het
Slc5a9 C A 4: 111,891,744 probably null Het
Slco1b2 T G 6: 141,656,743 probably benign Het
Smarca5 C A 8: 80,704,697 D964Y possibly damaging Het
Sptbn2 T A 19: 4,729,430 S338R possibly damaging Het
Srcap T C 7: 127,538,547 V1023A possibly damaging Het
Syt16 A G 12: 74,129,495 E46G probably damaging Het
Tas2r114 A T 6: 131,689,795 I90K probably damaging Het
Tlx1 G T 19: 45,150,979 D22Y probably damaging Het
Vamp8 G A 6: 72,385,539 L93F possibly damaging Het
Vill T C 9: 119,063,341 S347P possibly damaging Het
Zfp974 A G 7: 27,910,819 Y494H possibly damaging Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 195154251 missense possibly damaging 0.76
IGL01326:Cr2 APN 1 195141221 missense probably null 1.00
IGL01358:Cr2 APN 1 195159820 missense probably damaging 1.00
IGL01410:Cr2 APN 1 195163234 missense possibly damaging 0.49
IGL01468:Cr2 APN 1 195168535 missense probably damaging 1.00
IGL01608:Cr2 APN 1 195155220 missense possibly damaging 0.50
IGL01810:Cr2 APN 1 195159595 missense possibly damaging 0.49
IGL01843:Cr2 APN 1 195150914 splice site probably benign
IGL02332:Cr2 APN 1 195160322 missense probably benign 0.19
IGL02934:Cr2 APN 1 195154325 splice site probably benign
IGL02938:Cr2 APN 1 195166388 missense probably damaging 1.00
IGL03149:Cr2 APN 1 195166366 missense probably damaging 1.00
IGL03327:Cr2 APN 1 195169759 missense probably damaging 1.00
IGL03346:Cr2 APN 1 195169759 missense probably damaging 1.00
Pillar UTSW 1 195155888 nonsense probably null
PIT4354001:Cr2 UTSW 1 195166309 missense probably damaging 1.00
PIT4418001:Cr2 UTSW 1 195157452 missense probably benign 0.08
R0128:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0130:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0380:Cr2 UTSW 1 195157407 missense probably damaging 1.00
R0538:Cr2 UTSW 1 195160359 splice site probably benign
R0605:Cr2 UTSW 1 195163596 splice site probably benign
R0626:Cr2 UTSW 1 195171111 missense possibly damaging 0.95
R1135:Cr2 UTSW 1 195157190 missense probably damaging 1.00
R1396:Cr2 UTSW 1 195169253 splice site probably null
R1422:Cr2 UTSW 1 195171125 missense probably benign 0.01
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1511:Cr2 UTSW 1 195155272 missense possibly damaging 0.92
R1572:Cr2 UTSW 1 195163314 missense probably damaging 1.00
R1714:Cr2 UTSW 1 195151686 missense possibly damaging 0.46
R1748:Cr2 UTSW 1 195155905 nonsense probably null
R1761:Cr2 UTSW 1 195155123 critical splice donor site probably null
R1824:Cr2 UTSW 1 195157316 missense probably damaging 1.00
R1893:Cr2 UTSW 1 195155187 missense probably benign 0.03
R1990:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1991:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1992:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R2191:Cr2 UTSW 1 195163381 missense possibly damaging 0.94
R2276:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R2277:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R3548:Cr2 UTSW 1 195155888 nonsense probably null
R3743:Cr2 UTSW 1 195149966 splice site probably benign
R3941:Cr2 UTSW 1 195165814 missense probably damaging 0.97
R3963:Cr2 UTSW 1 195159739 missense probably damaging 1.00
R4211:Cr2 UTSW 1 195156328 missense probably damaging 0.96
R4484:Cr2 UTSW 1 195154174 missense probably damaging 1.00
R4546:Cr2 UTSW 1 195171041 missense possibly damaging 0.94
R4791:Cr2 UTSW 1 195155935 missense probably damaging 1.00
R4801:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4802:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4874:Cr2 UTSW 1 195176570 missense possibly damaging 0.82
R4885:Cr2 UTSW 1 195158731 missense possibly damaging 0.92
R5154:Cr2 UTSW 1 195159446 missense probably damaging 1.00
R5574:Cr2 UTSW 1 195141236 missense probably damaging 1.00
R5594:Cr2 UTSW 1 195157190 missense probably damaging 1.00
R5645:Cr2 UTSW 1 195154273 missense probably damaging 1.00
R5700:Cr2 UTSW 1 195159757 missense probably damaging 0.96
R5929:Cr2 UTSW 1 195171111 missense possibly damaging 0.91
R6237:Cr2 UTSW 1 195157502 missense probably damaging 1.00
R6299:Cr2 UTSW 1 195168646 missense probably damaging 1.00
R6368:Cr2 UTSW 1 195168472 missense probably damaging 1.00
R6406:Cr2 UTSW 1 195169771 missense probably damaging 1.00
R6618:Cr2 UTSW 1 195157379 missense probably damaging 0.98
R6684:Cr2 UTSW 1 195171021 nonsense probably null
R6720:Cr2 UTSW 1 195155200 missense probably damaging 0.97
R6866:Cr2 UTSW 1 195151691 missense probably damaging 1.00
R6915:Cr2 UTSW 1 195171146 missense probably benign 0.06
R7057:Cr2 UTSW 1 195151610 missense possibly damaging 0.83
R7117:Cr2 UTSW 1 195160601 missense possibly damaging 0.79
R7200:Cr2 UTSW 1 195163249 missense probably damaging 1.00
R7209:Cr2 UTSW 1 195168724 missense probably damaging 1.00
R7350:Cr2 UTSW 1 195155286 missense probably benign 0.21
X0028:Cr2 UTSW 1 195149982 missense probably benign 0.09
X0066:Cr2 UTSW 1 195166321 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATCAGGAGACAGAGGGATCTC -3'
(R):5'- GTGCTTCACAAATCTTCAGTACCC -3'

Sequencing Primer
(F):5'- TCTCCAAAGGTGTCAGGGAC -3'
(R):5'- ATCTTCAGTACCCAGCGCC -3'
Posted On2016-03-17