Mutagenetix > Incidental Mutation

Incidental Mutation 'R4889:Sptbn2'

377216

Institutional Source

Beutler Lab

Gene Symbol

Sptbn2

Ensembl Gene

ENSMUSG00000067889

Gene Name

spectrin beta, non-erythrocytic 2

Synonyms

Spnb3

MMRRC Submission

042494-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4889 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4761195-4802388 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 4779458 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 338 (S338R)

Ref Sequence

ENSEMBL: ENSMUSP00000008991 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008991]

AlphaFold

Q68FG2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000008991
AA Change: S338R

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000008991
Gene: ENSMUSG00000067889
AA Change: S338R

Domain	Start	End	E-Value	Type
CH	59	159	1.86e-28	SMART
CH	178	276	2.86e-20	SMART
SPEC	308	414	4.63e-1	SMART
SPEC	428	528	3.07e-23	SMART
SPEC	534	638	4.47e-25	SMART
SPEC	644	744	1.28e-25	SMART
SPEC	750	849	4.98e-23	SMART
SPEC	855	955	1.63e-18	SMART
SPEC	961	1062	1.45e-24	SMART
SPEC	1068	1169	4.15e-20	SMART
SPEC	1175	1275	5.26e-22	SMART
SPEC	1281	1380	1.17e-19	SMART
SPEC	1386	1485	2.06e-24	SMART
SPEC	1491	1585	1.74e-22	SMART
SPEC	1591	1691	5.42e-24	SMART
SPEC	1697	1798	2.1e-21	SMART
SPEC	1804	1904	5.47e-20	SMART
SPEC	1910	2010	1.99e-22	SMART
SPEC	2016	2256	2.92e-6	SMART
PH	2219	2330	1.65e-14	SMART
low complexity region	2373	2386	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are principle components of a cell's membrane-cytoskeleton and are composed of two alpha and two beta spectrin subunits. The protein encoded by this gene (SPTBN2), is called spectrin beta non-erythrocytic 2 or beta-III spectrin. It is related to, but distinct from, the beta-II spectrin gene which is also known as spectrin beta non-erythrocytic 1 (SPTBN1). SPTBN2 regulates the glutamate signaling pathway by stabilizing the glutamate transporter EAAT4 at the surface of the plasma membrane. Mutations in this gene cause a form of spinocerebellar ataxia, SCA5, that is characterized by neurodegeneration, progressive locomotor incoordination, dysarthria, and uncoordinated eye movements. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous hypomorphic mutants exhibit a progressive ataxic phenotype with gait abnormalities, tremor, deteriorating motor coordination, Purkinje cell loss, and cerebellar atrophy (molecular layer thinning) and age-related reduction in simple firing ratein surviving Purkinje cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ado	G	C	10: 67,384,135 (GRCm39)	R157G	probably benign	Het
Akap12	C	A	10: 4,306,535 (GRCm39)	A1115E	probably damaging	Het
Ankhd1	A	G	18: 36,711,787 (GRCm39)	M196V	probably null	Het
Appl2	G	A	10: 83,476,922 (GRCm39)	T34I	probably damaging	Het
Arhgap21	T	C	2: 20,885,279 (GRCm39)	S472G	probably benign	Het
Asmt	G	T	X: 169,110,764 (GRCm39)	R250L	possibly damaging	Het
Baz2b	A	T	2: 59,767,070 (GRCm39)	I870N	probably damaging	Het
Card11	T	C	5: 140,871,700 (GRCm39)	Q667R	possibly damaging	Het
Cercam	A	G	2: 29,771,845 (GRCm39)	D555G	probably damaging	Het
Cop1	A	T	1: 159,112,159 (GRCm39)	R284S	probably damaging	Het
Cr2	A	G	1: 194,858,893 (GRCm39)	V9A	possibly damaging	Het
Ctsm	A	G	13: 61,686,215 (GRCm39)	F106S	probably damaging	Het
Dhx9	A	T	1: 153,356,895 (GRCm39)	L118Q	probably damaging	Het
Dnah5	G	T	15: 28,235,938 (GRCm39)	C355F	probably benign	Het
Dock1	C	A	7: 134,346,705 (GRCm39)	N212K	probably benign	Het
Efemp2	T	A	19: 5,525,148 (GRCm39)	L18Q	probably null	Het
Flvcr1	A	G	1: 190,757,764 (GRCm39)	L176P	probably damaging	Het
Gm16505	A	T	13: 3,411,125 (GRCm39)		noncoding transcript	Het
Gm6457	A	T	18: 14,703,501 (GRCm39)		noncoding transcript	Het
Gnptab	A	G	10: 88,269,775 (GRCm39)	N826S	probably benign	Het
Hdc	T	G	2: 126,436,053 (GRCm39)	N606T	probably benign	Het
Itga3	T	C	11: 94,959,127 (GRCm39)	D113G	probably benign	Het
Maml3	C	T	3: 51,601,931 (GRCm39)		probably benign	Het
Mkrn1	A	T	6: 39,396,939 (GRCm39)		probably benign	Het
Myo18a	T	C	11: 77,723,238 (GRCm39)	V720A	probably damaging	Het
Nkx3-1	G	A	14: 69,428,447 (GRCm39)		probably null	Het
Npat	T	C	9: 53,473,507 (GRCm39)	I433T	probably benign	Het
Ofcc1	G	A	13: 40,168,864 (GRCm39)	T841I	probably damaging	Het
Or10ag53	A	T	2: 87,082,991 (GRCm39)	I237F	probably damaging	Het
Or1l4	A	G	2: 37,092,057 (GRCm39)	Y268C	probably damaging	Het
Or5m12	C	T	2: 85,735,092 (GRCm39)	C102Y	possibly damaging	Het
Pde6c	T	A	19: 38,121,599 (GRCm39)	M69K	probably benign	Het
Pde7b	T	C	10: 20,423,823 (GRCm39)	T18A	probably benign	Het
Plcz1	T	C	6: 139,953,474 (GRCm39)	K381R	probably benign	Het
Ppfia4	A	C	1: 134,228,252 (GRCm39)	F1095V	probably damaging	Het
Sfxn3	T	C	19: 45,038,254 (GRCm39)	F78S	probably damaging	Het
Sim1	A	T	10: 50,857,420 (GRCm39)	Y390F	probably benign	Het
Slc25a31	A	G	3: 40,675,975 (GRCm39)	I174V	probably benign	Het
Slc5a9	C	A	4: 111,748,941 (GRCm39)		probably null	Het
Slco1b2	T	G	6: 141,602,469 (GRCm39)		probably benign	Het
Smarca5	C	A	8: 81,431,326 (GRCm39)	D964Y	possibly damaging	Het
Srcap	T	C	7: 127,137,719 (GRCm39)	V1023A	possibly damaging	Het
Syt16	A	G	12: 74,176,269 (GRCm39)	E46G	probably damaging	Het
Tas2r114	A	T	6: 131,666,758 (GRCm39)	I90K	probably damaging	Het
Tlx1	G	T	19: 45,139,418 (GRCm39)	D22Y	probably damaging	Het
Vamp8	G	A	6: 72,362,522 (GRCm39)	L93F	possibly damaging	Het
Vill	T	C	9: 118,892,409 (GRCm39)	S347P	possibly damaging	Het
Zfp974	A	G	7: 27,610,244 (GRCm39)	Y494H	possibly damaging	Het

Other mutations in Sptbn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Sptbn2	APN	19	4,774,733 (GRCm39)	missense	possibly damaging	0.94
IGL00688:Sptbn2	APN	19	4,775,966 (GRCm39)	missense	probably damaging	1.00
IGL01339:Sptbn2	APN	19	4,796,000 (GRCm39)	nonsense	probably null
IGL01373:Sptbn2	APN	19	4,796,000 (GRCm39)	nonsense	probably null
IGL01420:Sptbn2	APN	19	4,784,153 (GRCm39)	missense	probably benign
IGL01456:Sptbn2	APN	19	4,796,777 (GRCm39)	missense	probably damaging	1.00
IGL01953:Sptbn2	APN	19	4,799,721 (GRCm39)	missense	probably benign
IGL03026:Sptbn2	APN	19	4,774,261 (GRCm39)	critical splice donor site	probably null
IGL03275:Sptbn2	APN	19	4,782,689 (GRCm39)	missense	possibly damaging	0.65
IGL03286:Sptbn2	APN	19	4,797,860 (GRCm39)	missense	probably damaging	0.97
F5770:Sptbn2	UTSW	19	4,800,660 (GRCm39)	missense	probably damaging	1.00
PIT4696001:Sptbn2	UTSW	19	4,795,605 (GRCm39)	missense	probably benign	0.00
R0046:Sptbn2	UTSW	19	4,795,405 (GRCm39)	intron	probably benign
R0046:Sptbn2	UTSW	19	4,795,405 (GRCm39)	intron	probably benign
R0121:Sptbn2	UTSW	19	4,795,321 (GRCm39)	missense	probably damaging	1.00
R0127:Sptbn2	UTSW	19	4,774,772 (GRCm39)	missense	probably damaging	1.00
R0212:Sptbn2	UTSW	19	4,796,970 (GRCm39)	critical splice donor site	probably null
R0277:Sptbn2	UTSW	19	4,795,173 (GRCm39)	missense	probably benign	0.28
R0417:Sptbn2	UTSW	19	4,787,954 (GRCm39)	missense	probably benign	0.01
R0457:Sptbn2	UTSW	19	4,795,966 (GRCm39)	missense	possibly damaging	0.89
R0536:Sptbn2	UTSW	19	4,776,718 (GRCm39)	missense	probably damaging	0.99
R0631:Sptbn2	UTSW	19	4,790,014 (GRCm39)	missense	probably benign	0.01
R0734:Sptbn2	UTSW	19	4,798,151 (GRCm39)	nonsense	probably null
R0742:Sptbn2	UTSW	19	4,769,011 (GRCm39)	missense	possibly damaging	0.46
R1195:Sptbn2	UTSW	19	4,795,921 (GRCm39)	missense	possibly damaging	0.85
R1195:Sptbn2	UTSW	19	4,795,921 (GRCm39)	missense	possibly damaging	0.85
R1195:Sptbn2	UTSW	19	4,795,921 (GRCm39)	missense	possibly damaging	0.85
R1364:Sptbn2	UTSW	19	4,782,693 (GRCm39)	missense	probably damaging	1.00
R1495:Sptbn2	UTSW	19	4,769,004 (GRCm39)	missense	possibly damaging	0.92
R1498:Sptbn2	UTSW	19	4,794,274 (GRCm39)	missense	possibly damaging	0.94
R1606:Sptbn2	UTSW	19	4,800,270 (GRCm39)	critical splice donor site	probably null
R1678:Sptbn2	UTSW	19	4,800,525 (GRCm39)	missense	probably damaging	1.00
R1746:Sptbn2	UTSW	19	4,795,992 (GRCm39)	nonsense	probably null
R1820:Sptbn2	UTSW	19	4,776,624 (GRCm39)	missense	probably damaging	0.98
R1830:Sptbn2	UTSW	19	4,782,569 (GRCm39)	missense	probably benign	0.09
R1863:Sptbn2	UTSW	19	4,782,713 (GRCm39)	missense	possibly damaging	0.54
R1967:Sptbn2	UTSW	19	4,795,327 (GRCm39)	missense	probably benign	0.00
R2085:Sptbn2	UTSW	19	4,788,587 (GRCm39)	missense	probably benign	0.09
R2301:Sptbn2	UTSW	19	4,784,166 (GRCm39)	missense	probably benign	0.00
R2310:Sptbn2	UTSW	19	4,768,963 (GRCm39)	missense	probably benign	0.19
R2888:Sptbn2	UTSW	19	4,798,664 (GRCm39)	missense	possibly damaging	0.52
R3788:Sptbn2	UTSW	19	4,795,950 (GRCm39)	missense	probably damaging	1.00
R4429:Sptbn2	UTSW	19	4,788,383 (GRCm39)	missense	probably damaging	1.00
R4536:Sptbn2	UTSW	19	4,782,630 (GRCm39)	missense	probably damaging	1.00
R4662:Sptbn2	UTSW	19	4,789,267 (GRCm39)	missense	probably damaging	1.00
R4672:Sptbn2	UTSW	19	4,782,524 (GRCm39)	missense	probably benign	0.25
R4731:Sptbn2	UTSW	19	4,792,508 (GRCm39)	missense	probably damaging	0.96
R4747:Sptbn2	UTSW	19	4,798,182 (GRCm39)	missense	probably benign	0.27
R4891:Sptbn2	UTSW	19	4,788,497 (GRCm39)	missense	probably damaging	1.00
R4965:Sptbn2	UTSW	19	4,779,337 (GRCm39)	missense	probably benign	0.13
R4968:Sptbn2	UTSW	19	4,779,230 (GRCm39)	splice site	probably null
R4981:Sptbn2	UTSW	19	4,801,686 (GRCm39)	missense	probably benign	0.22
R5159:Sptbn2	UTSW	19	4,787,885 (GRCm39)	missense	probably benign	0.12
R5202:Sptbn2	UTSW	19	4,774,212 (GRCm39)	missense	probably damaging	1.00
R5253:Sptbn2	UTSW	19	4,800,110 (GRCm39)	missense	probably benign	0.01
R5294:Sptbn2	UTSW	19	4,768,936 (GRCm39)	missense	possibly damaging	0.67
R5465:Sptbn2	UTSW	19	4,800,133 (GRCm39)	missense	probably benign	0.00
R5546:Sptbn2	UTSW	19	4,775,978 (GRCm39)	missense	probably damaging	1.00
R5593:Sptbn2	UTSW	19	4,798,975 (GRCm39)	missense	probably damaging	1.00
R5780:Sptbn2	UTSW	19	4,774,695 (GRCm39)	missense	probably damaging	1.00
R5835:Sptbn2	UTSW	19	4,788,247 (GRCm39)	missense	probably damaging	1.00
R6008:Sptbn2	UTSW	19	4,789,306 (GRCm39)	missense	possibly damaging	0.89
R6108:Sptbn2	UTSW	19	4,781,420 (GRCm39)	critical splice donor site	probably null
R6236:Sptbn2	UTSW	19	4,798,166 (GRCm39)	missense	probably benign	0.01
R6307:Sptbn2	UTSW	19	4,774,674 (GRCm39)	missense	probably damaging	1.00
R6383:Sptbn2	UTSW	19	4,782,524 (GRCm39)	missense	possibly damaging	0.89
R6397:Sptbn2	UTSW	19	4,792,446 (GRCm39)	missense	possibly damaging	0.91
R6453:Sptbn2	UTSW	19	4,794,208 (GRCm39)	missense	possibly damaging	0.67
R6561:Sptbn2	UTSW	19	4,797,954 (GRCm39)	missense	probably benign	0.39
R6564:Sptbn2	UTSW	19	4,782,052 (GRCm39)	missense	probably damaging	1.00
R6644:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R6703:Sptbn2	UTSW	19	4,799,843 (GRCm39)	missense	probably benign
R6703:Sptbn2	UTSW	19	4,799,842 (GRCm39)	missense	probably benign
R6753:Sptbn2	UTSW	19	4,797,813 (GRCm39)	missense	probably benign	0.01
R7007:Sptbn2	UTSW	19	4,794,173 (GRCm39)	missense	possibly damaging	0.82
R7131:Sptbn2	UTSW	19	4,799,488 (GRCm39)	missense	probably null
R7219:Sptbn2	UTSW	19	4,774,201 (GRCm39)	missense	probably damaging	1.00
R7285:Sptbn2	UTSW	19	4,787,471 (GRCm39)	missense	probably benign	0.00
R7308:Sptbn2	UTSW	19	4,801,602 (GRCm39)	missense	probably benign
R7469:Sptbn2	UTSW	19	4,795,146 (GRCm39)	missense	probably benign	0.00
R7502:Sptbn2	UTSW	19	4,798,110 (GRCm39)	missense	probably benign	0.02
R7623:Sptbn2	UTSW	19	4,776,196 (GRCm39)	missense	probably damaging	1.00
R7635:Sptbn2	UTSW	19	4,794,235 (GRCm39)	missense	probably damaging	1.00
R7733:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7738:Sptbn2	UTSW	19	4,774,153 (GRCm39)	missense	probably damaging	1.00
R7742:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7767:Sptbn2	UTSW	19	4,784,171 (GRCm39)	missense	possibly damaging	0.62
R7795:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7796:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7871:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7877:Sptbn2	UTSW	19	4,794,290 (GRCm39)	missense	possibly damaging	0.93
R7920:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7921:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7923:Sptbn2	UTSW	19	4,796,827 (GRCm39)	missense	probably benign	0.01
R8137:Sptbn2	UTSW	19	4,787,431 (GRCm39)	missense	possibly damaging	0.81
R8305:Sptbn2	UTSW	19	4,779,158 (GRCm39)	missense	possibly damaging	0.81
R8695:Sptbn2	UTSW	19	4,796,724 (GRCm39)	missense	possibly damaging	0.86
R8790:Sptbn2	UTSW	19	4,782,052 (GRCm39)	missense	probably damaging	1.00
R9125:Sptbn2	UTSW	19	4,784,241 (GRCm39)	missense	probably benign	0.04
R9483:Sptbn2	UTSW	19	4,789,974 (GRCm39)	missense	probably damaging	1.00
R9620:Sptbn2	UTSW	19	4,800,535 (GRCm39)	missense	probably damaging	0.99
R9631:Sptbn2	UTSW	19	4,788,218 (GRCm39)	missense	probably damaging	1.00
R9646:Sptbn2	UTSW	19	4,795,341 (GRCm39)	missense	probably damaging	1.00
R9694:Sptbn2	UTSW	19	4,800,535 (GRCm39)	missense	probably damaging	0.99
V7580:Sptbn2	UTSW	19	4,800,660 (GRCm39)	missense	probably damaging	1.00
Z1176:Sptbn2	UTSW	19	4,795,219 (GRCm39)	missense	probably benign	0.01
Z1176:Sptbn2	UTSW	19	4,788,233 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCACTGTGTGAGATACCCAC -3'
(R):5'- AACAACTGTGCTGTTTGGATG -3'

Sequencing Primer
(F):5'- TGTGAGATACCCACCTGCCTG -3'
(R):5'- GAACAAGCCTTGGCTGCATTTC -3'

Posted On

2016-03-17