Incidental Mutation 'R4892:Fmo3'
ID377331
Institutional Source Beutler Lab
Gene Symbol Fmo3
Ensembl Gene ENSMUSG00000026691
Gene Nameflavin containing monooxygenase 3
Synonyms
MMRRC Submission 042497-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R4892 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location162953800-162984528 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 162968731 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 91 (I91F)
Ref Sequence ENSEMBL: ENSMUSP00000028010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028010]
Predicted Effect probably benign
Transcript: ENSMUST00000028010
AA Change: I91F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000028010
Gene: ENSMUSG00000026691
AA Change: I91F

DomainStartEndE-ValueType
Pfam:FMO-like 2 534 7.7e-286 PFAM
Pfam:Pyr_redox_2 3 245 4.4e-15 PFAM
Pfam:Pyr_redox_3 6 220 1.1e-11 PFAM
Pfam:NAD_binding_8 7 71 3.1e-7 PFAM
Pfam:K_oxygenase 79 224 6.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142759
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Flavin-containing monooxygenases (FMO) are an important class of drug-metabolizing enzymes that catalyze the NADPH-dependent oxygenation of various nitrogen-,sulfur-, and phosphorous-containing xenobiotics such as therapeutic drugs, dietary compounds, pesticides, and other foreign compounds. The human FMO gene family is composed of 5 genes and multiple pseudogenes. FMO members have distinct developmental- and tissue-specific expression patterns. The expression of this FMO3 gene, the major FMO expressed in adult liver, can vary up to 20-fold between individuals. This inter-individual variation in FMO3 expression levels is likely to have significant effects on the rate at which xenobiotics are metabolised and, therefore, is of considerable interest to the pharmaceutical industry. This transmembrane protein localizes to the endoplasmic reticulum of many tissues. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. Mutations in this gene cause the disorder trimethylaminuria (TMAu) which is characterized by the accumulation and excretion of unmetabolized trimethylamine and a distinctive body odor. In healthy individuals, trimethylamine is primarily converted to the non odorous trimethylamine N-oxide.[provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T C 8: 86,509,802 T1128A probably benign Het
Apol11a A T 15: 77,516,990 K226* probably null Het
Atp4a A G 7: 30,712,474 M45V probably benign Het
Babam1 T A 8: 71,403,052 M263K probably benign Het
Capn11 GACA GA 17: 45,633,097 probably null Het
Ccdc190 C A 1: 169,930,109 L46I possibly damaging Het
Cep131 C T 11: 120,068,057 R717H probably damaging Het
Cpt1c A G 7: 44,959,588 F770L probably benign Het
Dhx30 A T 9: 110,085,856 probably null Het
Dido1 G A 2: 180,675,029 Q662* probably null Het
Dip2a T C 10: 76,280,759 E910G probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Gdap1 A C 1: 17,159,994 D217A possibly damaging Het
Grm1 T C 10: 10,719,587 S766G possibly damaging Het
Kat8 T A 7: 127,915,538 I123N possibly damaging Het
Kcnt2 C A 1: 140,513,025 S23* probably null Het
Krt73 G A 15: 101,795,809 T432I probably damaging Het
Lgals9 T A 11: 78,966,083 I223L probably benign Het
Mpo T A 11: 87,802,681 N48K probably benign Het
Myo9a T G 9: 59,824,242 H632Q probably damaging Het
Olfr1386 C A 11: 49,470,216 Q22K probably benign Het
Olfr1412 A G 1: 92,588,921 N197S probably benign Het
Prelid2 A G 18: 41,951,144 F11S possibly damaging Het
Setd1a G T 7: 127,778,524 V57L probably damaging Het
Sgip1 A G 4: 102,966,234 D704G probably damaging Het
Spryd3 T C 15: 102,118,102 E378G probably benign Het
Stk17b A T 1: 53,771,611 Y112N probably damaging Het
Syndig1 A T 2: 149,899,891 K132N probably damaging Het
Tcf20 C T 15: 82,854,199 R1017Q possibly damaging Het
Tenm3 T A 8: 48,276,861 D1370V probably damaging Het
Tnrc6a C T 7: 123,169,911 T308I probably damaging Het
Ttc29 T C 8: 78,333,645 V398A probably damaging Het
Ubr4 A G 4: 139,428,517 T2218A probably benign Het
Other mutations in Fmo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Fmo3 APN 1 162964030 missense probably benign 0.15
IGL01124:Fmo3 APN 1 162958261 missense probably damaging 1.00
IGL01645:Fmo3 APN 1 162964006 missense possibly damaging 0.53
IGL01710:Fmo3 APN 1 162983043 missense probably damaging 1.00
IGL01943:Fmo3 APN 1 162967006 missense probably benign 0.01
IGL02489:Fmo3 APN 1 162954287 missense possibly damaging 0.75
IGL02503:Fmo3 APN 1 162968864 missense probably benign 0.03
IGL02743:Fmo3 APN 1 162958483 missense probably damaging 1.00
IGL02974:Fmo3 APN 1 162983050 missense probably damaging 1.00
IGL03023:Fmo3 APN 1 162958465 missense probably benign 0.00
R0554:Fmo3 UTSW 1 162954332 missense probably benign 0.03
R0629:Fmo3 UTSW 1 162958227 splice site probably benign
R1209:Fmo3 UTSW 1 162964028 missense probably benign 0.00
R1213:Fmo3 UTSW 1 162967823 missense probably damaging 1.00
R1612:Fmo3 UTSW 1 162967885 missense probably damaging 1.00
R1636:Fmo3 UTSW 1 162954425 missense probably benign
R1710:Fmo3 UTSW 1 162967787 missense possibly damaging 0.59
R1764:Fmo3 UTSW 1 162958573 missense possibly damaging 0.79
R1775:Fmo3 UTSW 1 162968725 missense possibly damaging 0.54
R1906:Fmo3 UTSW 1 162966906 missense probably damaging 1.00
R2363:Fmo3 UTSW 1 162954315 missense probably damaging 0.98
R2418:Fmo3 UTSW 1 162966958 missense probably benign
R2519:Fmo3 UTSW 1 162958305 missense probably damaging 1.00
R3940:Fmo3 UTSW 1 162963986 missense probably benign 0.01
R3977:Fmo3 UTSW 1 162958578 missense probably damaging 0.99
R4779:Fmo3 UTSW 1 162968838 missense probably damaging 1.00
R4846:Fmo3 UTSW 1 162954311 missense possibly damaging 0.94
R5102:Fmo3 UTSW 1 162963977 missense probably benign 0.01
R5516:Fmo3 UTSW 1 162954426 nonsense probably null
R6035:Fmo3 UTSW 1 162964036 missense probably damaging 0.97
R6035:Fmo3 UTSW 1 162964036 missense probably damaging 0.97
R7050:Fmo3 UTSW 1 162963904 missense probably damaging 0.98
R7088:Fmo3 UTSW 1 162968865 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCCTATTTCTGACAGATTCCTGAG -3'
(R):5'- TTACTACAGTGACTTGGAACTGAG -3'

Sequencing Primer
(F):5'- AGTTCAAGGCCAGCATGTTC -3'
(R):5'- GACTTGGAACTGAGTATTTTTACCC -3'
Posted On2016-03-17