Incidental Mutation 'R4894:Fbxo18'
ID377463
Institutional Source Beutler Lab
Gene Symbol Fbxo18
Ensembl Gene ENSMUSG00000058594
Gene NameF-box protein 18
SynonymsFbx18
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R4894 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location11742573-11777582 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11762960 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 359 (I359N)
Ref Sequence ENSEMBL: ENSMUSP00000071495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071564]
Predicted Effect probably damaging
Transcript: ENSMUST00000071564
AA Change: I359N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000071495
Gene: ENSMUSG00000058594
AA Change: I359N

DomainStartEndE-ValueType
FBOX 213 256 3.94e-3 SMART
Pfam:UvrD-helicase 626 692 8e-10 PFAM
Pfam:UvrD_C 862 935 1.7e-12 PFAM
Pfam:UvrD_C_2 867 931 1.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192171
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbx class. It contains an F-box motif and seven conserved helicase motifs, and has both DNA-dependent ATPase and DNA unwinding activities. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf1 C A 17: 43,299,084 Y176* probably null Het
Akap13 T A 7: 75,725,320 M1900K possibly damaging Het
Ankrd36 A G 11: 5,635,332 E381G probably damaging Het
Ap3s1 T C 18: 46,758,116 probably null Het
Cacna1e G T 1: 154,488,805 S341* probably null Het
Camk1d G A 2: 5,354,728 S161L probably damaging Het
Cdh23 G T 10: 60,337,851 H1619Q probably benign Het
Chd7 T A 4: 8,838,629 I1276N probably damaging Het
Clca1 A G 3: 145,013,901 V436A probably damaging Het
Ctcfl G A 2: 173,117,403 P177S probably benign Het
Dab2ip A G 2: 35,730,527 probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Epc1 A T 18: 6,449,011 S495R probably benign Het
Espl1 A G 15: 102,322,323 probably null Het
Eya4 T C 10: 23,109,854 E583G possibly damaging Het
Fam111a C G 19: 12,588,549 T554R probably benign Het
Fer1l6 T C 15: 58,618,902 C1023R probably damaging Het
Gm14139 T A 2: 150,191,979 C104* probably null Het
Helz2 G C 2: 181,236,147 P953A probably benign Het
Ifi204 G T 1: 173,760,242 S117Y probably damaging Het
Igfn1 G A 1: 135,954,782 T2775M probably damaging Het
Igsf9 A G 1: 172,498,067 T1101A probably benign Het
Ipo13 A C 4: 117,903,441 I614S probably damaging Het
Ipo13 A G 4: 117,904,490 I476T possibly damaging Het
Kdm2b C A 5: 122,940,967 E308* probably null Het
Klhl20 A T 1: 161,109,532 M91K possibly damaging Het
Klrb1f T C 6: 129,053,188 F64L probably benign Het
Ldlrad3 C T 2: 102,057,948 C106Y probably damaging Het
Lilra6 T C 7: 3,912,531 T161A probably benign Het
Lrriq1 A T 10: 103,161,752 M1334K possibly damaging Het
Mepe C G 5: 104,325,402 P3R probably damaging Het
Mgat4e A G 1: 134,541,118 V396A probably benign Het
Nfx1 T G 4: 40,996,877 S651A probably damaging Het
Olfr1214 T C 2: 88,987,439 I254M possibly damaging Het
Olfr1337 A T 4: 118,782,286 C100S probably damaging Het
Olfr1361 T C 13: 21,659,182 N47S probably damaging Het
Rag2 T C 2: 101,629,677 S111P probably damaging Het
Rai1 T A 11: 60,186,746 D545E probably damaging Het
Ralgps1 A G 2: 33,143,103 V498A possibly damaging Het
Rasal2 G A 1: 157,192,804 S205L probably damaging Het
Rec8 T C 14: 55,625,330 L582P probably damaging Het
Retn G A 8: 3,657,358 R106H probably damaging Het
Rnf112 A G 11: 61,452,662 L116P probably damaging Het
Rnf213 T C 11: 119,481,240 Y4885H probably damaging Het
Sacm1l A G 9: 123,582,344 I399M probably benign Het
Sez6 G T 11: 77,975,260 G738V probably damaging Het
Spata17 A G 1: 187,140,446 V56A probably benign Het
Spata31d1a A T 13: 59,701,728 V862D probably damaging Het
Sptb A G 12: 76,624,994 probably null Het
Srpk2 C A 5: 23,545,529 G59W probably damaging Het
Ttc30a1 T C 2: 75,979,744 *665W probably null Het
Tyro3 T C 2: 119,802,298 S96P probably damaging Het
Ube2v1 A G 2: 167,610,360 S108P probably damaging Het
Usp2 C T 9: 44,075,828 S141L probably benign Het
Vamp5 T C 6: 72,370,198 D46G possibly damaging Het
Vmn1r23 T A 6: 57,926,325 Q156L probably benign Het
Vmn2r6 C T 3: 64,547,408 S490N probably benign Het
Vps39 A T 2: 120,352,959 I10N probably damaging Het
Vwf C T 6: 125,645,934 Q1755* probably null Het
Wdfy4 A T 14: 33,155,760 H82Q probably benign Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Wdr72 A G 9: 74,210,561 T852A probably benign Het
Zfp1 T A 8: 111,669,723 C92* probably null Het
Zfp426 A T 9: 20,475,073 probably benign Het
Zfp442 C T 2: 150,411,210 probably null Het
Zfp74 T C 7: 29,936,045 probably benign Het
Other mutations in Fbxo18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Fbxo18 APN 2 11757523 nonsense probably null
IGL02081:Fbxo18 APN 2 11764127 missense probably benign 0.31
IGL02082:Fbxo18 APN 2 11764127 missense probably benign 0.31
IGL02084:Fbxo18 APN 2 11764127 missense probably benign 0.31
IGL02086:Fbxo18 APN 2 11764127 missense probably benign 0.31
IGL02369:Fbxo18 APN 2 11747158 missense possibly damaging 0.61
IGL02584:Fbxo18 APN 2 11759958 missense probably benign 0.07
IGL03138:Fbxo18 UTSW 2 11749509 intron probably benign
R0384:Fbxo18 UTSW 2 11749578 missense probably damaging 1.00
R0479:Fbxo18 UTSW 2 11758419 missense probably damaging 1.00
R0972:Fbxo18 UTSW 2 11764088 splice site probably benign
R1420:Fbxo18 UTSW 2 11767682 missense probably benign 0.01
R1827:Fbxo18 UTSW 2 11763888 missense possibly damaging 0.88
R1832:Fbxo18 UTSW 2 11767400 missense probably benign 0.08
R1960:Fbxo18 UTSW 2 11757528 missense probably damaging 0.98
R2040:Fbxo18 UTSW 2 11769895 missense possibly damaging 0.66
R2044:Fbxo18 UTSW 2 11762970 missense possibly damaging 0.89
R2102:Fbxo18 UTSW 2 11758289 missense probably benign 0.18
R3236:Fbxo18 UTSW 2 11769826 missense probably damaging 1.00
R3975:Fbxo18 UTSW 2 11767210 missense possibly damaging 0.72
R4504:Fbxo18 UTSW 2 11749017 missense possibly damaging 0.91
R4505:Fbxo18 UTSW 2 11749017 missense possibly damaging 0.91
R4507:Fbxo18 UTSW 2 11749017 missense possibly damaging 0.91
R4799:Fbxo18 UTSW 2 11755747 missense probably damaging 1.00
R4994:Fbxo18 UTSW 2 11764230 missense probably damaging 1.00
R5579:Fbxo18 UTSW 2 11748993 missense probably damaging 0.97
R5801:Fbxo18 UTSW 2 11769826 missense probably damaging 1.00
R6255:Fbxo18 UTSW 2 11748446 missense probably benign 0.31
R7011:Fbxo18 UTSW 2 11762963 missense probably damaging 1.00
R7177:Fbxo18 UTSW 2 11755711 missense probably damaging 1.00
R7243:Fbxo18 UTSW 2 11751525 missense probably benign 0.11
R7331:Fbxo18 UTSW 2 11763986 missense probably benign
R7361:Fbxo18 UTSW 2 11747076 missense probably damaging 1.00
R7460:Fbxo18 UTSW 2 11756685 missense probably benign 0.38
R7541:Fbxo18 UTSW 2 11749537 missense not run
Predicted Primers PCR Primer
(F):5'- GCTAGGACAAGTCTAGGCCTTG -3'
(R):5'- CACTGGGTAATTTGAAAGGGGC -3'

Sequencing Primer
(F):5'- GCCTTGCCACGCTATCCTAG -3'
(R):5'- ATTGAAGGCTTGACTACAGATGCC -3'
Posted On2016-03-17