Incidental Mutation 'R4894:Olfr1337'
ID377482
Institutional Source Beutler Lab
Gene Symbol Olfr1337
Ensembl Gene ENSMUSG00000111159
Gene Nameolfactory receptor 1337
SynonymsGA_x6K02T2QD9B-18767132-18768073, Olfr219-ps1, GA_x6K02SYWGW3-414-3, MOR259-10
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R4894 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location118781636-118782586 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118782286 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 100 (C100S)
Ref Sequence ENSEMBL: ENSMUSP00000076483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077247]
Predicted Effect probably damaging
Transcript: ENSMUST00000077247
AA Change: C100S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076483
Gene: ENSMUSG00000111159
AA Change: C100S

DomainStartEndE-ValueType
Pfam:7tm_4 34 310 7.8e-53 PFAM
Pfam:7TM_GPCR_Srsx 38 308 8.5e-7 PFAM
Pfam:7tm_1 44 293 8.3e-23 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf1 C A 17: 43,299,084 Y176* probably null Het
Akap13 T A 7: 75,725,320 M1900K possibly damaging Het
Ankrd36 A G 11: 5,635,332 E381G probably damaging Het
Ap3s1 T C 18: 46,758,116 probably null Het
Cacna1e G T 1: 154,488,805 S341* probably null Het
Camk1d G A 2: 5,354,728 S161L probably damaging Het
Cdh23 G T 10: 60,337,851 H1619Q probably benign Het
Chd7 T A 4: 8,838,629 I1276N probably damaging Het
Clca1 A G 3: 145,013,901 V436A probably damaging Het
Ctcfl G A 2: 173,117,403 P177S probably benign Het
Dab2ip A G 2: 35,730,527 probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Epc1 A T 18: 6,449,011 S495R probably benign Het
Espl1 A G 15: 102,322,323 probably null Het
Eya4 T C 10: 23,109,854 E583G possibly damaging Het
Fam111a C G 19: 12,588,549 T554R probably benign Het
Fbxo18 A T 2: 11,762,960 I359N probably damaging Het
Fer1l6 T C 15: 58,618,902 C1023R probably damaging Het
Gm14139 T A 2: 150,191,979 C104* probably null Het
Helz2 G C 2: 181,236,147 P953A probably benign Het
Ifi204 G T 1: 173,760,242 S117Y probably damaging Het
Igfn1 G A 1: 135,954,782 T2775M probably damaging Het
Igsf9 A G 1: 172,498,067 T1101A probably benign Het
Ipo13 A C 4: 117,903,441 I614S probably damaging Het
Ipo13 A G 4: 117,904,490 I476T possibly damaging Het
Kdm2b C A 5: 122,940,967 E308* probably null Het
Klhl20 A T 1: 161,109,532 M91K possibly damaging Het
Klrb1f T C 6: 129,053,188 F64L probably benign Het
Ldlrad3 C T 2: 102,057,948 C106Y probably damaging Het
Lilra6 T C 7: 3,912,531 T161A probably benign Het
Lrriq1 A T 10: 103,161,752 M1334K possibly damaging Het
Mepe C G 5: 104,325,402 P3R probably damaging Het
Mgat4e A G 1: 134,541,118 V396A probably benign Het
Nfx1 T G 4: 40,996,877 S651A probably damaging Het
Olfr1214 T C 2: 88,987,439 I254M possibly damaging Het
Olfr1361 T C 13: 21,659,182 N47S probably damaging Het
Rag2 T C 2: 101,629,677 S111P probably damaging Het
Rai1 T A 11: 60,186,746 D545E probably damaging Het
Ralgps1 A G 2: 33,143,103 V498A possibly damaging Het
Rasal2 G A 1: 157,192,804 S205L probably damaging Het
Rec8 T C 14: 55,625,330 L582P probably damaging Het
Retn G A 8: 3,657,358 R106H probably damaging Het
Rnf112 A G 11: 61,452,662 L116P probably damaging Het
Rnf213 T C 11: 119,481,240 Y4885H probably damaging Het
Sacm1l A G 9: 123,582,344 I399M probably benign Het
Sez6 G T 11: 77,975,260 G738V probably damaging Het
Spata17 A G 1: 187,140,446 V56A probably benign Het
Spata31d1a A T 13: 59,701,728 V862D probably damaging Het
Sptb A G 12: 76,624,994 probably null Het
Srpk2 C A 5: 23,545,529 G59W probably damaging Het
Ttc30a1 T C 2: 75,979,744 *665W probably null Het
Tyro3 T C 2: 119,802,298 S96P probably damaging Het
Ube2v1 A G 2: 167,610,360 S108P probably damaging Het
Usp2 C T 9: 44,075,828 S141L probably benign Het
Vamp5 T C 6: 72,370,198 D46G possibly damaging Het
Vmn1r23 T A 6: 57,926,325 Q156L probably benign Het
Vmn2r6 C T 3: 64,547,408 S490N probably benign Het
Vps39 A T 2: 120,352,959 I10N probably damaging Het
Vwf C T 6: 125,645,934 Q1755* probably null Het
Wdfy4 A T 14: 33,155,760 H82Q probably benign Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Wdr72 A G 9: 74,210,561 T852A probably benign Het
Zfp1 T A 8: 111,669,723 C92* probably null Het
Zfp426 A T 9: 20,475,073 probably benign Het
Zfp442 C T 2: 150,411,210 probably null Het
Zfp74 T C 7: 29,936,045 probably benign Het
Other mutations in Olfr1337
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02203:Olfr1337 APN 4 118782429 missense possibly damaging 0.95
IGL02626:Olfr1337 APN 4 118782334 missense probably damaging 0.98
IGL02699:Olfr1337 APN 4 118782152 nonsense probably null
IGL02754:Olfr1337 APN 4 118781920 missense possibly damaging 0.90
IGL03287:Olfr1337 APN 4 118782354 missense possibly damaging 0.64
R1341:Olfr1337 UTSW 4 118782382 missense probably benign 0.01
R6124:Olfr1337 UTSW 4 118782195 missense probably damaging 1.00
R6515:Olfr1337 UTSW 4 118782270 missense probably benign 0.13
R6529:Olfr1337 UTSW 4 118781710 missense probably benign 0.15
R7040:Olfr1337 UTSW 4 118781986 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCCTGTTGGGTCCACAATATG -3'
(R):5'- GCAATGGGCTCATCATCATG -3'

Sequencing Primer
(F):5'- CCACAATATGGCAGACTCATGGTG -3'
(R):5'- ATGGGCTCATCATCATGCTGGTC -3'
Posted On2016-03-17