Incidental Mutation 'R4894:Kdm2b'
ID377484
Institutional Source Beutler Lab
Gene Symbol Kdm2b
Ensembl Gene ENSMUSG00000029475
Gene Namelysine (K)-specific demethylase 2B
SynonymsJhdm1b, Fbxl10, Cxxc2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4894 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location122870665-122989823 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 122940967 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 308 (E308*)
Ref Sequence ENSEMBL: ENSMUSP00000118488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046073] [ENSMUST00000086200] [ENSMUST00000118027] [ENSMUST00000121739] [ENSMUST00000127403] [ENSMUST00000145082] [ENSMUST00000156474]
Predicted Effect probably null
Transcript: ENSMUST00000046073
AA Change: E314*
SMART Domains Protein: ENSMUSP00000038229
Gene: ENSMUSG00000029475
AA Change: E314*

DomainStartEndE-ValueType
Blast:JmjC 23 101 4e-41 BLAST
JmjC 147 315 3.61e-41 SMART
low complexity region 380 401 N/A INTRINSIC
low complexity region 406 424 N/A INTRINSIC
PDB:2YU2|A 472 546 1e-17 PDB
Pfam:zf-CXXC 578 624 3e-17 PFAM
PHD 634 696 8.58e-4 SMART
low complexity region 792 823 N/A INTRINSIC
low complexity region 903 913 N/A INTRINSIC
low complexity region 990 1006 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
FBOX 1038 1078 1.69e-2 SMART
LRR 1121 1143 1.31e2 SMART
LRR 1145 1170 2.9e2 SMART
LRR 1185 1209 2.04e2 SMART
LRR 1210 1235 1.1e1 SMART
LRR 1265 1290 3.91e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000086200
AA Change: E308*
SMART Domains Protein: ENSMUSP00000083376
Gene: ENSMUSG00000029475
AA Change: E308*

DomainStartEndE-ValueType
Blast:JmjC 17 95 4e-41 BLAST
JmjC 141 309 3.61e-41 SMART
low complexity region 374 395 N/A INTRINSIC
low complexity region 400 418 N/A INTRINSIC
PDB:2YU2|A 466 540 1e-17 PDB
Pfam:zf-CXXC 572 618 2.1e-17 PFAM
PHD 628 690 8.58e-4 SMART
low complexity region 786 817 N/A INTRINSIC
low complexity region 897 907 N/A INTRINSIC
low complexity region 984 1000 N/A INTRINSIC
low complexity region 1012 1026 N/A INTRINSIC
FBOX 1032 1072 1.69e-2 SMART
LRR 1115 1137 1.31e2 SMART
LRR 1139 1164 2.9e2 SMART
LRR 1179 1203 2.04e2 SMART
LRR 1204 1229 1.1e1 SMART
LRR 1259 1284 3.91e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000118027
AA Change: E314*
SMART Domains Protein: ENSMUSP00000114052
Gene: ENSMUSG00000029475
AA Change: E314*

DomainStartEndE-ValueType
Blast:JmjC 23 101 4e-41 BLAST
JmjC 147 315 3.61e-41 SMART
low complexity region 380 401 N/A INTRINSIC
low complexity region 406 424 N/A INTRINSIC
PDB:2YU2|A 472 546 9e-18 PDB
Pfam:zf-CXXC 578 624 2.1e-17 PFAM
PHD 634 696 8.58e-4 SMART
low complexity region 865 875 N/A INTRINSIC
low complexity region 952 968 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
FBOX 1000 1040 1.69e-2 SMART
LRR 1083 1105 1.31e2 SMART
LRR 1107 1132 2.9e2 SMART
LRR 1147 1171 2.04e2 SMART
LRR 1172 1197 1.1e1 SMART
LRR 1227 1252 3.91e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121739
AA Change: E259*
SMART Domains Protein: ENSMUSP00000114049
Gene: ENSMUSG00000029475
AA Change: E259*

DomainStartEndE-ValueType
Blast:JmjC 1 46 2e-19 BLAST
JmjC 92 260 3.61e-41 SMART
low complexity region 325 346 N/A INTRINSIC
low complexity region 351 369 N/A INTRINSIC
PDB:2YU2|A 417 491 1e-17 PDB
Pfam:zf-CXXC 523 569 5.4e-17 PFAM
PHD 579 641 8.58e-4 SMART
low complexity region 737 768 N/A INTRINSIC
low complexity region 848 858 N/A INTRINSIC
low complexity region 935 951 N/A INTRINSIC
low complexity region 963 977 N/A INTRINSIC
FBOX 983 1023 1.69e-2 SMART
LRR 1066 1088 1.31e2 SMART
LRR 1090 1115 2.9e2 SMART
LRR 1130 1154 2.04e2 SMART
LRR 1155 1180 1.1e1 SMART
LRR 1210 1235 3.91e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123479
Predicted Effect probably benign
Transcript: ENSMUST00000127403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143273
Predicted Effect probably null
Transcript: ENSMUST00000145082
AA Change: E114*
SMART Domains Protein: ENSMUSP00000114731
Gene: ENSMUSG00000029475
AA Change: E114*

DomainStartEndE-ValueType
JmjC 1 115 4.87e-15 SMART
Blast:JmjC 118 286 7e-65 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147544
Predicted Effect probably null
Transcript: ENSMUST00000156474
AA Change: E308*
SMART Domains Protein: ENSMUSP00000118488
Gene: ENSMUSG00000029475
AA Change: E308*

DomainStartEndE-ValueType
Blast:JmjC 17 95 3e-42 BLAST
JmjC 141 309 3.61e-41 SMART
low complexity region 374 395 N/A INTRINSIC
low complexity region 400 418 N/A INTRINSIC
PDB:2YU2|A 466 512 1e-8 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a H3K36-specific histone demethylase, which contains an N-terminal jumonji C domain, a CxxC zinc finger domain, a plant homeodomain finger, an F-box, and eight leucine-rich repeats. Amongst its demonstrated functions, this protein plays roles in the suppression of premature cellular senescence, leukemia maintenance and development, maintenance of mouse embryonic stem cell pluripotency, and induced pluripotent stem cell generation. Mice homozygous for a targeted deletion of the zinc finger domain display embryonic lethality with development ceasing at approximately 7 to 8 days post coitum, demonstrating an essential role in early development. A pseudogene of this gene is found on chromosome 4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a targeted allele that does not express the long form protein exhibit exencephaly, fetal and postnatal lethality, coloboma, curly tail, oligozoospermia, increased apoptosis, and increased neuronal precursor proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf1 C A 17: 43,299,084 Y176* probably null Het
Akap13 T A 7: 75,725,320 M1900K possibly damaging Het
Ankrd36 A G 11: 5,635,332 E381G probably damaging Het
Ap3s1 T C 18: 46,758,116 probably null Het
Cacna1e G T 1: 154,488,805 S341* probably null Het
Camk1d G A 2: 5,354,728 S161L probably damaging Het
Cdh23 G T 10: 60,337,851 H1619Q probably benign Het
Chd7 T A 4: 8,838,629 I1276N probably damaging Het
Clca1 A G 3: 145,013,901 V436A probably damaging Het
Ctcfl G A 2: 173,117,403 P177S probably benign Het
Dab2ip A G 2: 35,730,527 probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Epc1 A T 18: 6,449,011 S495R probably benign Het
Espl1 A G 15: 102,322,323 probably null Het
Eya4 T C 10: 23,109,854 E583G possibly damaging Het
Fam111a C G 19: 12,588,549 T554R probably benign Het
Fbxo18 A T 2: 11,762,960 I359N probably damaging Het
Fer1l6 T C 15: 58,618,902 C1023R probably damaging Het
Gm14139 T A 2: 150,191,979 C104* probably null Het
Helz2 G C 2: 181,236,147 P953A probably benign Het
Ifi204 G T 1: 173,760,242 S117Y probably damaging Het
Igfn1 G A 1: 135,954,782 T2775M probably damaging Het
Igsf9 A G 1: 172,498,067 T1101A probably benign Het
Ipo13 A C 4: 117,903,441 I614S probably damaging Het
Ipo13 A G 4: 117,904,490 I476T possibly damaging Het
Klhl20 A T 1: 161,109,532 M91K possibly damaging Het
Klrb1f T C 6: 129,053,188 F64L probably benign Het
Ldlrad3 C T 2: 102,057,948 C106Y probably damaging Het
Lilra6 T C 7: 3,912,531 T161A probably benign Het
Lrriq1 A T 10: 103,161,752 M1334K possibly damaging Het
Mepe C G 5: 104,325,402 P3R probably damaging Het
Mgat4e A G 1: 134,541,118 V396A probably benign Het
Nfx1 T G 4: 40,996,877 S651A probably damaging Het
Olfr1214 T C 2: 88,987,439 I254M possibly damaging Het
Olfr1337 A T 4: 118,782,286 C100S probably damaging Het
Olfr1361 T C 13: 21,659,182 N47S probably damaging Het
Rag2 T C 2: 101,629,677 S111P probably damaging Het
Rai1 T A 11: 60,186,746 D545E probably damaging Het
Ralgps1 A G 2: 33,143,103 V498A possibly damaging Het
Rasal2 G A 1: 157,192,804 S205L probably damaging Het
Rec8 T C 14: 55,625,330 L582P probably damaging Het
Retn G A 8: 3,657,358 R106H probably damaging Het
Rnf112 A G 11: 61,452,662 L116P probably damaging Het
Rnf213 T C 11: 119,481,240 Y4885H probably damaging Het
Sacm1l A G 9: 123,582,344 I399M probably benign Het
Sez6 G T 11: 77,975,260 G738V probably damaging Het
Spata17 A G 1: 187,140,446 V56A probably benign Het
Spata31d1a A T 13: 59,701,728 V862D probably damaging Het
Sptb A G 12: 76,624,994 probably null Het
Srpk2 C A 5: 23,545,529 G59W probably damaging Het
Ttc30a1 T C 2: 75,979,744 *665W probably null Het
Tyro3 T C 2: 119,802,298 S96P probably damaging Het
Ube2v1 A G 2: 167,610,360 S108P probably damaging Het
Usp2 C T 9: 44,075,828 S141L probably benign Het
Vamp5 T C 6: 72,370,198 D46G possibly damaging Het
Vmn1r23 T A 6: 57,926,325 Q156L probably benign Het
Vmn2r6 C T 3: 64,547,408 S490N probably benign Het
Vps39 A T 2: 120,352,959 I10N probably damaging Het
Vwf C T 6: 125,645,934 Q1755* probably null Het
Wdfy4 A T 14: 33,155,760 H82Q probably benign Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Wdr72 A G 9: 74,210,561 T852A probably benign Het
Zfp1 T A 8: 111,669,723 C92* probably null Het
Zfp426 A T 9: 20,475,073 probably benign Het
Zfp442 C T 2: 150,411,210 probably null Het
Zfp74 T C 7: 29,936,045 probably benign Het
Other mutations in Kdm2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Kdm2b APN 5 122961567 missense probably damaging 1.00
IGL02061:Kdm2b APN 5 122883341 missense probably damaging 1.00
IGL02142:Kdm2b APN 5 122947835 missense probably damaging 0.99
IGL02143:Kdm2b APN 5 122947835 missense probably damaging 0.99
IGL02147:Kdm2b APN 5 122947835 missense probably damaging 0.99
IGL02294:Kdm2b APN 5 122961474 missense probably damaging 1.00
IGL02309:Kdm2b APN 5 122947820 missense probably damaging 0.99
IGL03039:Kdm2b APN 5 122881671 missense probably benign 0.06
IGL03134:Kdm2b UTSW 5 122932674 missense probably damaging 1.00
PIT4520001:Kdm2b UTSW 5 122941047 missense probably damaging 1.00
R0008:Kdm2b UTSW 5 122881743 missense probably benign 0.08
R0592:Kdm2b UTSW 5 122961134 splice site probably benign
R0894:Kdm2b UTSW 5 122984460 critical splice donor site probably null
R1078:Kdm2b UTSW 5 122961541 missense possibly damaging 0.83
R1387:Kdm2b UTSW 5 122880268 missense probably damaging 1.00
R1441:Kdm2b UTSW 5 122932880 missense probably benign 0.25
R1550:Kdm2b UTSW 5 122881057 missense probably damaging 1.00
R1795:Kdm2b UTSW 5 122984460 critical splice donor site probably null
R2060:Kdm2b UTSW 5 122883365 missense probably damaging 1.00
R2161:Kdm2b UTSW 5 122880699 missense probably damaging 1.00
R2259:Kdm2b UTSW 5 122882416 missense probably damaging 1.00
R3843:Kdm2b UTSW 5 122934793 missense probably damaging 0.98
R3844:Kdm2b UTSW 5 122934793 missense probably damaging 0.98
R3859:Kdm2b UTSW 5 122880227 missense probably damaging 1.00
R4506:Kdm2b UTSW 5 122888625 missense possibly damaging 0.58
R4680:Kdm2b UTSW 5 122934786 missense probably damaging 0.99
R4786:Kdm2b UTSW 5 122880854 critical splice acceptor site probably null
R5265:Kdm2b UTSW 5 122878588 missense probably damaging 1.00
R5522:Kdm2b UTSW 5 122949162 missense probably damaging 1.00
R5746:Kdm2b UTSW 5 122879364 missense probably damaging 1.00
R5813:Kdm2b UTSW 5 122871868 missense probably benign 0.37
R5920:Kdm2b UTSW 5 122880296 missense probably damaging 1.00
R5961:Kdm2b UTSW 5 122932661 missense probably benign 0.37
R6029:Kdm2b UTSW 5 122879587 missense probably damaging 1.00
R6280:Kdm2b UTSW 5 122878624 missense probably damaging 1.00
R6303:Kdm2b UTSW 5 122881744 missense probably benign 0.34
R6304:Kdm2b UTSW 5 122881744 missense probably benign 0.34
R6383:Kdm2b UTSW 5 122934778 missense probably damaging 1.00
R6432:Kdm2b UTSW 5 122880191 missense probably damaging 1.00
R6513:Kdm2b UTSW 5 122880239 missense probably damaging 0.99
R6526:Kdm2b UTSW 5 122961469 missense probably damaging 1.00
R7213:Kdm2b UTSW 5 122921469 missense probably damaging 0.99
R7226:Kdm2b UTSW 5 122921449 missense possibly damaging 0.60
R7292:Kdm2b UTSW 5 122880791 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTGCCTACGCCTGAACTTG -3'
(R):5'- GCATCACATGTCCTTGCACATC -3'

Sequencing Primer
(F):5'- CTTGAACAGAAACTCCAGAGATTTGG -3'
(R):5'- ATGTCCTTGCACATCCGTGTC -3'
Posted On2016-03-17