Mutagenetix > Incidental Mutation

Incidental Mutation 'R4894:Rnf213'

377510

Institutional Source

Beutler Lab

Gene Symbol

Rnf213

Ensembl Gene

ENSMUSG00000070327

Gene Name

ring finger protein 213

Synonyms

D11Ertd759e

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4894 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

119283926-119378244 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 119372066 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 4885 (Y4885H)

Ref Sequence

ENSEMBL: ENSMUSP00000115063 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035] [ENSMUST00000172235]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000093902
AA Change: Y4886H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: Y4886H

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1546	1558	N/A	INTRINSIC
AAA	2373	2515	2.82e-2	SMART
AAA	2722	2890	3.63e-1	SMART
low complexity region	3449	3459	N/A	INTRINSIC
RING	3947	3985	8.69e-5	SMART
Blast:PP2Ac	4544	4722	3e-66	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000131035
AA Change: Y4885H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: Y4885H

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1113	1127	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
AAA	2372	2514	2.82e-2	SMART
AAA	2721	2889	3.63e-1	SMART
low complexity region	3448	3458	N/A	INTRINSIC
RING	3946	3984	8.69e-5	SMART
Blast:PP2Ac	4542	4720	3e-66	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000172235
AA Change: Y46H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207133

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207273

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207446

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208152

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208476

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrf1	C	A	17: 43,609,975 (GRCm39)	Y176*	probably null	Het
Akap13	T	A	7: 75,375,068 (GRCm39)	M1900K	possibly damaging	Het
Ankrd36	A	G	11: 5,585,332 (GRCm39)	E381G	probably damaging	Het
Ap3s1	T	C	18: 46,891,183 (GRCm39)		probably null	Het
Cacna1e	G	T	1: 154,364,551 (GRCm39)	S341*	probably null	Het
Camk1d	G	A	2: 5,359,539 (GRCm39)	S161L	probably damaging	Het
Cdh23	G	T	10: 60,173,630 (GRCm39)	H1619Q	probably benign	Het
Chd7	T	A	4: 8,838,629 (GRCm39)	I1276N	probably damaging	Het
Clca3a1	A	G	3: 144,719,662 (GRCm39)	V436A	probably damaging	Het
Ctcfl	G	A	2: 172,959,196 (GRCm39)	P177S	probably benign	Het
Dab2ip	A	G	2: 35,620,539 (GRCm39)		probably benign	Het
Dnah8	G	A	17: 30,967,542 (GRCm39)	D2585N	probably benign	Het
Epc1	A	T	18: 6,449,011 (GRCm39)	S495R	probably benign	Het
Espl1	A	G	15: 102,230,758 (GRCm39)		probably null	Het
Eya4	T	C	10: 22,985,753 (GRCm39)	E583G	possibly damaging	Het
Fam111a	C	G	19: 12,565,913 (GRCm39)	T554R	probably benign	Het
Fbh1	A	T	2: 11,767,771 (GRCm39)	I359N	probably damaging	Het
Fer1l6	T	C	15: 58,490,751 (GRCm39)	C1023R	probably damaging	Het
Helz2	G	C	2: 180,877,940 (GRCm39)	P953A	probably benign	Het
Ifi204	G	T	1: 173,587,808 (GRCm39)	S117Y	probably damaging	Het
Ift70a1	T	C	2: 75,810,088 (GRCm39)	*665W	probably null	Het
Igfn1	G	A	1: 135,882,520 (GRCm39)	T2775M	probably damaging	Het
Igsf9	A	G	1: 172,325,634 (GRCm39)	T1101A	probably benign	Het
Ipo13	A	C	4: 117,760,638 (GRCm39)	I614S	probably damaging	Het
Ipo13	A	G	4: 117,761,687 (GRCm39)	I476T	possibly damaging	Het
Kdm2b	C	A	5: 123,079,030 (GRCm39)	E308*	probably null	Het
Klhl20	A	T	1: 160,937,102 (GRCm39)	M91K	possibly damaging	Het
Klrb1f	T	C	6: 129,030,151 (GRCm39)	F64L	probably benign	Het
Ldlrad3	C	T	2: 101,888,293 (GRCm39)	C106Y	probably damaging	Het
Lilra6	T	C	7: 3,915,530 (GRCm39)	T161A	probably benign	Het
Lrriq1	A	T	10: 102,997,613 (GRCm39)	M1334K	possibly damaging	Het
Mepe	C	G	5: 104,473,268 (GRCm39)	P3R	probably damaging	Het
Mgat4e	A	G	1: 134,468,856 (GRCm39)	V396A	probably benign	Het
Nfx1	T	G	4: 40,996,877 (GRCm39)	S651A	probably damaging	Het
Or10ak13	A	T	4: 118,639,483 (GRCm39)	C100S	probably damaging	Het
Or2w6	T	C	13: 21,843,352 (GRCm39)	N47S	probably damaging	Het
Or4c109	T	C	2: 88,817,783 (GRCm39)	I254M	possibly damaging	Het
Rag2	T	C	2: 101,460,022 (GRCm39)	S111P	probably damaging	Het
Rai1	T	A	11: 60,077,572 (GRCm39)	D545E	probably damaging	Het
Ralgps1	A	G	2: 33,033,115 (GRCm39)	V498A	possibly damaging	Het
Rasal2	G	A	1: 157,020,374 (GRCm39)	S205L	probably damaging	Het
Rec8	T	C	14: 55,862,787 (GRCm39)	L582P	probably damaging	Het
Retn	G	A	8: 3,707,358 (GRCm39)	R106H	probably damaging	Het
Rnf112	A	G	11: 61,343,488 (GRCm39)	L116P	probably damaging	Het
Sacm1l	A	G	9: 123,411,409 (GRCm39)	I399M	probably benign	Het
Sez6	G	T	11: 77,866,086 (GRCm39)	G738V	probably damaging	Het
Spata17	A	G	1: 186,872,643 (GRCm39)	V56A	probably benign	Het
Spata31d1a	A	T	13: 59,849,542 (GRCm39)	V862D	probably damaging	Het
Sptb	A	G	12: 76,671,768 (GRCm39)		probably null	Het
Srpk2	C	A	5: 23,750,527 (GRCm39)	G59W	probably damaging	Het
Tyro3	T	C	2: 119,632,779 (GRCm39)	S96P	probably damaging	Het
Ube2v1	A	G	2: 167,452,280 (GRCm39)	S108P	probably damaging	Het
Usp2	C	T	9: 43,987,125 (GRCm39)	S141L	probably benign	Het
Vamp5	T	C	6: 72,347,181 (GRCm39)	D46G	possibly damaging	Het
Vmn1r23	T	A	6: 57,903,310 (GRCm39)	Q156L	probably benign	Het
Vmn2r6	C	T	3: 64,454,829 (GRCm39)	S490N	probably benign	Het
Vps39	A	T	2: 120,183,440 (GRCm39)	I10N	probably damaging	Het
Vwf	C	T	6: 125,622,897 (GRCm39)	Q1755*	probably null	Het
Wdfy4	A	T	14: 32,877,717 (GRCm39)	H82Q	probably benign	Het
Wdr24	T	C	17: 26,045,101 (GRCm39)	Y279H	probably damaging	Het
Wdr72	A	G	9: 74,117,843 (GRCm39)	T852A	probably benign	Het
Zfp1	T	A	8: 112,396,355 (GRCm39)	C92*	probably null	Het
Zfp1004	T	A	2: 150,033,899 (GRCm39)	C104*	probably null	Het
Zfp426	A	T	9: 20,386,369 (GRCm39)		probably benign	Het
Zfp442	C	T	2: 150,253,130 (GRCm39)		probably null	Het
Zfp74	T	C	7: 29,635,470 (GRCm39)		probably benign	Het

Other mutations in Rnf213

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Rnf213	APN	11	119,340,169 (GRCm39)	missense	probably benign	0.00
IGL00961:Rnf213	APN	11	119,331,669 (GRCm39)	missense	possibly damaging	0.55
IGL01324:Rnf213	APN	11	119,338,063 (GRCm39)	missense	probably damaging	1.00
IGL01351:Rnf213	APN	11	119,373,944 (GRCm39)	missense	probably benign	0.25
IGL01403:Rnf213	APN	11	119,334,126 (GRCm39)	missense	probably damaging	1.00
IGL01704:Rnf213	APN	11	119,340,702 (GRCm39)	critical splice donor site	probably null
IGL01765:Rnf213	APN	11	119,327,178 (GRCm39)	missense	probably benign	0.00
IGL01803:Rnf213	APN	11	119,332,133 (GRCm39)	missense	probably damaging	1.00
IGL01804:Rnf213	APN	11	119,333,092 (GRCm39)	missense	probably damaging	1.00
IGL01900:Rnf213	APN	11	119,333,841 (GRCm39)	missense	probably benign	0.05
IGL01944:Rnf213	APN	11	119,307,283 (GRCm39)	missense	probably benign	0.01
IGL01982:Rnf213	APN	11	119,334,094 (GRCm39)	missense	probably damaging	1.00
IGL02008:Rnf213	APN	11	119,309,135 (GRCm39)	splice site	probably benign
IGL02084:Rnf213	APN	11	119,336,499 (GRCm39)	missense	probably benign	0.04
IGL02253:Rnf213	APN	11	119,331,476 (GRCm39)	missense	probably benign	0.03
IGL02254:Rnf213	APN	11	119,371,733 (GRCm39)	missense	possibly damaging	0.89
IGL02296:Rnf213	APN	11	119,354,162 (GRCm39)	missense	probably benign	0.01
IGL02531:Rnf213	APN	11	119,327,628 (GRCm39)	missense	probably benign
IGL02588:Rnf213	APN	11	119,307,362 (GRCm39)	missense	probably benign	0.30
IGL02615:Rnf213	APN	11	119,331,615 (GRCm39)	missense	probably damaging	0.96
IGL02805:Rnf213	APN	11	119,325,892 (GRCm39)	missense	probably damaging	0.99
IGL02887:Rnf213	APN	11	119,318,336 (GRCm39)	missense	probably damaging	1.00
IGL03001:Rnf213	APN	11	119,370,767 (GRCm39)	missense	probably damaging	1.00
IGL03035:Rnf213	APN	11	119,336,452 (GRCm39)	splice site	probably benign
IGL03057:Rnf213	APN	11	119,331,913 (GRCm39)	missense	probably damaging	1.00
IGL03148:Rnf213	APN	11	119,355,833 (GRCm39)	missense	probably damaging	1.00
IGL03308:Rnf213	APN	11	119,364,998 (GRCm39)	missense	probably benign	0.03
IGL03339:Rnf213	APN	11	119,333,830 (GRCm39)	missense	probably damaging	1.00
IGL03369:Rnf213	APN	11	119,312,294 (GRCm39)	missense	probably benign	0.34
attrition	UTSW	11	119,321,147 (GRCm39)	missense	possibly damaging	0.77
defame	UTSW	11	119,321,107 (GRCm39)	nonsense	probably null
Derogate	UTSW	11	119,361,036 (GRCm39)	missense	probably damaging	1.00
dinky	UTSW	11	119,307,284 (GRCm39)	missense	probably damaging	0.99
G1funyon_rnf213_024	UTSW	11	119,325,568 (GRCm39)	missense
Impugn	UTSW	11	119,327,649 (GRCm39)	nonsense	probably null
R4332_Rnf213_642	UTSW	11	119,327,502 (GRCm39)	missense	probably damaging	1.00
B6584:Rnf213	UTSW	11	119,316,895 (GRCm39)	missense	probably damaging	0.97
G1Funyon:Rnf213	UTSW	11	119,325,568 (GRCm39)	missense
PIT4585001:Rnf213	UTSW	11	119,349,218 (GRCm39)	missense
R0008:Rnf213	UTSW	11	119,355,878 (GRCm39)	missense	possibly damaging	0.82
R0015:Rnf213	UTSW	11	119,332,432 (GRCm39)	missense	possibly damaging	0.95
R0041:Rnf213	UTSW	11	119,293,401 (GRCm39)	missense	probably benign	0.41
R0114:Rnf213	UTSW	11	119,305,413 (GRCm39)	missense	probably damaging	1.00
R0131:Rnf213	UTSW	11	119,321,187 (GRCm39)	missense	probably benign	0.10
R0131:Rnf213	UTSW	11	119,321,187 (GRCm39)	missense	probably benign	0.10
R0132:Rnf213	UTSW	11	119,321,187 (GRCm39)	missense	probably benign	0.10
R0138:Rnf213	UTSW	11	119,307,322 (GRCm39)	missense	probably benign	0.05
R0144:Rnf213	UTSW	11	119,370,426 (GRCm39)	nonsense	probably null
R0184:Rnf213	UTSW	11	119,305,347 (GRCm39)	missense	probably damaging	0.99
R0321:Rnf213	UTSW	11	119,328,931 (GRCm39)	nonsense	probably null
R0365:Rnf213	UTSW	11	119,316,937 (GRCm39)	missense	possibly damaging	0.74
R0415:Rnf213	UTSW	11	119,305,295 (GRCm39)	missense	probably damaging	1.00
R0421:Rnf213	UTSW	11	119,338,083 (GRCm39)	missense	probably damaging	1.00
R0494:Rnf213	UTSW	11	119,316,838 (GRCm39)	missense	possibly damaging	0.65
R0494:Rnf213	UTSW	11	119,333,946 (GRCm39)	missense	probably damaging	1.00
R0549:Rnf213	UTSW	11	119,355,908 (GRCm39)	missense	probably damaging	1.00
R0577:Rnf213	UTSW	11	119,334,106 (GRCm39)	missense	probably damaging	1.00
R0605:Rnf213	UTSW	11	119,322,543 (GRCm39)	missense	probably benign	0.03
R0638:Rnf213	UTSW	11	119,361,036 (GRCm39)	missense	probably damaging	1.00
R0675:Rnf213	UTSW	11	119,332,660 (GRCm39)	missense	probably benign	0.28
R0715:Rnf213	UTSW	11	119,331,976 (GRCm39)	missense	probably damaging	0.97
R0732:Rnf213	UTSW	11	119,331,894 (GRCm39)	missense	probably damaging	0.99
R0748:Rnf213	UTSW	11	119,364,306 (GRCm39)	missense	probably damaging	1.00
R0765:Rnf213	UTSW	11	119,313,921 (GRCm39)	critical splice donor site	probably null
R0890:Rnf213	UTSW	11	119,321,312 (GRCm39)	missense	possibly damaging	0.94
R0927:Rnf213	UTSW	11	119,305,396 (GRCm39)	missense	probably benign	0.00
R0940:Rnf213	UTSW	11	119,307,389 (GRCm39)	missense	probably benign	0.10
R0959:Rnf213	UTSW	11	119,343,407 (GRCm39)	missense	probably damaging	0.99
R1077:Rnf213	UTSW	11	119,376,824 (GRCm39)	splice site	probably benign
R1104:Rnf213	UTSW	11	119,368,055 (GRCm39)	missense	probably benign	0.29
R1141:Rnf213	UTSW	11	119,326,809 (GRCm39)	missense	probably benign	0.02
R1219:Rnf213	UTSW	11	119,327,003 (GRCm39)	missense	probably damaging	1.00
R1435:Rnf213	UTSW	11	119,326,831 (GRCm39)	missense	probably damaging	1.00
R1444:Rnf213	UTSW	11	119,333,226 (GRCm39)	missense	probably damaging	1.00
R1474:Rnf213	UTSW	11	119,328,576 (GRCm39)	missense	probably damaging	1.00
R1488:Rnf213	UTSW	11	119,371,715 (GRCm39)	missense	probably benign	0.05
R1523:Rnf213	UTSW	11	119,332,714 (GRCm39)	missense	probably damaging	1.00
R1548:Rnf213	UTSW	11	119,333,533 (GRCm39)	missense	probably damaging	1.00
R1554:Rnf213	UTSW	11	119,332,665 (GRCm39)	missense	probably benign	0.06
R1563:Rnf213	UTSW	11	119,305,352 (GRCm39)	missense	probably benign	0.13
R1572:Rnf213	UTSW	11	119,327,437 (GRCm39)	missense	probably damaging	1.00
R1585:Rnf213	UTSW	11	119,354,171 (GRCm39)	missense	probably damaging	1.00
R1635:Rnf213	UTSW	11	119,333,405 (GRCm39)	missense	probably damaging	0.97
R1663:Rnf213	UTSW	11	119,328,498 (GRCm39)	missense	probably benign	0.01
R1789:Rnf213	UTSW	11	119,331,047 (GRCm39)	missense	probably damaging	0.97
R1844:Rnf213	UTSW	11	119,332,009 (GRCm39)	missense	probably damaging	1.00
R1871:Rnf213	UTSW	11	119,340,955 (GRCm39)	missense	probably benign	0.08
R1893:Rnf213	UTSW	11	119,307,274 (GRCm39)	missense	probably damaging	1.00
R1937:Rnf213	UTSW	11	119,322,511 (GRCm39)	missense	probably damaging	1.00
R1967:Rnf213	UTSW	11	119,371,721 (GRCm39)	missense	probably damaging	1.00
R1987:Rnf213	UTSW	11	119,331,933 (GRCm39)	missense	probably damaging	1.00
R2000:Rnf213	UTSW	11	119,326,848 (GRCm39)	missense	probably damaging	1.00
R2020:Rnf213	UTSW	11	119,352,744 (GRCm39)	missense	probably damaging	0.99
R2100:Rnf213	UTSW	11	119,358,128 (GRCm39)	nonsense	probably null
R2109:Rnf213	UTSW	11	119,333,489 (GRCm39)	nonsense	probably null
R2115:Rnf213	UTSW	11	119,318,839 (GRCm39)	missense	probably benign	0.00
R2126:Rnf213	UTSW	11	119,341,027 (GRCm39)	missense	probably damaging	0.99
R2144:Rnf213	UTSW	11	119,334,516 (GRCm39)	missense	probably damaging	0.99
R2145:Rnf213	UTSW	11	119,306,019 (GRCm39)	missense	probably benign	0.03
R2168:Rnf213	UTSW	11	119,305,896 (GRCm39)	missense	probably damaging	0.97
R2189:Rnf213	UTSW	11	119,321,187 (GRCm39)	missense	probably benign	0.10
R2199:Rnf213	UTSW	11	119,350,835 (GRCm39)	missense	probably benign	0.01
R2220:Rnf213	UTSW	11	119,327,254 (GRCm39)	missense	possibly damaging	0.94
R2336:Rnf213	UTSW	11	119,305,430 (GRCm39)	missense	probably benign	0.02
R2400:Rnf213	UTSW	11	119,334,021 (GRCm39)	missense	probably damaging	1.00
R2679:Rnf213	UTSW	11	119,350,764 (GRCm39)	splice site	probably null
R2698:Rnf213	UTSW	11	119,300,970 (GRCm39)	missense	probably benign	0.26
R3151:Rnf213	UTSW	11	119,359,718 (GRCm39)	missense	probably benign	0.03
R3607:Rnf213	UTSW	11	119,332,802 (GRCm39)	nonsense	probably null
R3808:Rnf213	UTSW	11	119,370,384 (GRCm39)	missense	probably damaging	1.00
R3854:Rnf213	UTSW	11	119,371,765 (GRCm39)	splice site	probably benign
R3856:Rnf213	UTSW	11	119,371,765 (GRCm39)	splice site	probably benign
R3973:Rnf213	UTSW	11	119,359,879 (GRCm39)	missense
R4014:Rnf213	UTSW	11	119,336,555 (GRCm39)	nonsense	probably null
R4049:Rnf213	UTSW	11	119,373,274 (GRCm39)	missense	possibly damaging	0.67
R4130:Rnf213	UTSW	11	119,373,832 (GRCm39)	missense	probably damaging	1.00
R4153:Rnf213	UTSW	11	119,300,308 (GRCm39)	missense	probably benign	0.27
R4167:Rnf213	UTSW	11	119,332,069 (GRCm39)	missense	probably damaging	0.99
R4224:Rnf213	UTSW	11	119,327,649 (GRCm39)	nonsense	probably null
R4332:Rnf213	UTSW	11	119,327,502 (GRCm39)	missense	probably damaging	1.00
R4415:Rnf213	UTSW	11	119,374,790 (GRCm39)	missense	probably damaging	0.99
R4547:Rnf213	UTSW	11	119,370,496 (GRCm39)	critical splice donor site	probably null
R4609:Rnf213	UTSW	11	119,328,521 (GRCm39)	missense	possibly damaging	0.86
R4684:Rnf213	UTSW	11	119,331,951 (GRCm39)	missense	probably damaging	1.00
R4704:Rnf213	UTSW	11	119,331,175 (GRCm39)	missense	probably damaging	1.00
R4719:Rnf213	UTSW	11	119,310,893 (GRCm39)	missense	probably benign	0.38
R4751:Rnf213	UTSW	11	119,336,571 (GRCm39)	missense	probably benign	0.12
R4828:Rnf213	UTSW	11	119,307,455 (GRCm39)	missense	possibly damaging	0.61
R4837:Rnf213	UTSW	11	119,333,589 (GRCm39)	missense	probably benign	0.00
R4973:Rnf213	UTSW	11	119,318,983 (GRCm39)	missense	possibly damaging	0.84
R5026:Rnf213	UTSW	11	119,327,590 (GRCm39)	missense	probably damaging	1.00
R5034:Rnf213	UTSW	11	119,301,633 (GRCm39)	missense	probably damaging	0.99
R5284:Rnf213	UTSW	11	119,349,692 (GRCm39)	missense	possibly damaging	0.89
R5295:Rnf213	UTSW	11	119,331,642 (GRCm39)	missense	probably benign	0.00
R5406:Rnf213	UTSW	11	119,331,634 (GRCm39)	missense	probably damaging	1.00
R5441:Rnf213	UTSW	11	119,299,846 (GRCm39)	missense	probably damaging	0.99
R5449:Rnf213	UTSW	11	119,305,902 (GRCm39)	missense	probably benign	0.44
R5520:Rnf213	UTSW	11	119,324,325 (GRCm39)	missense	probably damaging	1.00
R5636:Rnf213	UTSW	11	119,327,731 (GRCm39)	missense	probably damaging	1.00
R5636:Rnf213	UTSW	11	119,327,455 (GRCm39)	missense	probably benign	0.04
R5669:Rnf213	UTSW	11	119,349,611 (GRCm39)	missense	possibly damaging	0.92
R5670:Rnf213	UTSW	11	119,325,512 (GRCm39)	critical splice acceptor site	probably null
R5697:Rnf213	UTSW	11	119,374,720 (GRCm39)	missense	possibly damaging	0.54
R5726:Rnf213	UTSW	11	119,307,284 (GRCm39)	missense	probably damaging	0.99
R5808:Rnf213	UTSW	11	119,327,121 (GRCm39)	missense	probably benign
R5861:Rnf213	UTSW	11	119,364,203 (GRCm39)	missense	probably damaging	1.00
R5903:Rnf213	UTSW	11	119,312,195 (GRCm39)	missense	probably damaging	0.98
R5949:Rnf213	UTSW	11	119,333,905 (GRCm39)	missense	probably damaging	1.00
R6022:Rnf213	UTSW	11	119,376,836 (GRCm39)	missense	probably benign	0.00
R6043:Rnf213	UTSW	11	119,332,927 (GRCm39)	missense	probably damaging	0.97
R6089:Rnf213	UTSW	11	119,307,385 (GRCm39)	missense	probably benign	0.14
R6123:Rnf213	UTSW	11	119,302,339 (GRCm39)	missense	probably damaging	0.96
R6134:Rnf213	UTSW	11	119,302,296 (GRCm39)	missense	probably damaging	0.99
R6135:Rnf213	UTSW	11	119,332,854 (GRCm39)	missense	probably benign	0.02
R6146:Rnf213	UTSW	11	119,326,825 (GRCm39)	missense	probably benign	0.41
R6163:Rnf213	UTSW	11	119,349,254 (GRCm39)	missense	possibly damaging	0.86
R6272:Rnf213	UTSW	11	119,305,374 (GRCm39)	missense	probably damaging	1.00
R6333:Rnf213	UTSW	11	119,354,192 (GRCm39)	missense	probably damaging	1.00
R6370:Rnf213	UTSW	11	119,367,904 (GRCm39)	missense	probably damaging	0.99
R6456:Rnf213	UTSW	11	119,350,792 (GRCm39)	missense	probably benign	0.03
R6468:Rnf213	UTSW	11	119,343,513 (GRCm39)	missense	possibly damaging	0.94
R6579:Rnf213	UTSW	11	119,327,106 (GRCm39)	missense	probably damaging	0.96
R6648:Rnf213	UTSW	11	119,370,746 (GRCm39)	missense	possibly damaging	0.81
R6727:Rnf213	UTSW	11	119,321,147 (GRCm39)	missense	possibly damaging	0.77
R6739:Rnf213	UTSW	11	119,333,097 (GRCm39)	missense	probably damaging	1.00
R6768:Rnf213	UTSW	11	119,333,062 (GRCm39)	missense	probably damaging	0.99
R6817:Rnf213	UTSW	11	119,353,111 (GRCm39)	critical splice donor site	probably null
R6820:Rnf213	UTSW	11	119,339,664 (GRCm39)	missense	probably damaging	1.00
R6841:Rnf213	UTSW	11	119,340,692 (GRCm39)	missense	probably benign	0.26
R6934:Rnf213	UTSW	11	119,310,893 (GRCm39)	missense	probably benign	0.38
R7026:Rnf213	UTSW	11	119,370,481 (GRCm39)	missense	possibly damaging	0.58
R7094:Rnf213	UTSW	11	119,328,430 (GRCm39)	splice site	probably null
R7170:Rnf213	UTSW	11	119,343,401 (GRCm39)	missense
R7185:Rnf213	UTSW	11	119,315,024 (GRCm39)	missense
R7239:Rnf213	UTSW	11	119,349,614 (GRCm39)	missense
R7258:Rnf213	UTSW	11	119,343,401 (GRCm39)	missense
R7259:Rnf213	UTSW	11	119,343,401 (GRCm39)	missense
R7260:Rnf213	UTSW	11	119,343,401 (GRCm39)	missense
R7273:Rnf213	UTSW	11	119,322,582 (GRCm39)	splice site	probably null
R7282:Rnf213	UTSW	11	119,328,818 (GRCm39)	missense
R7311:Rnf213	UTSW	11	119,307,373 (GRCm39)	missense
R7352:Rnf213	UTSW	11	119,334,405 (GRCm39)	missense
R7369:Rnf213	UTSW	11	119,321,294 (GRCm39)	missense
R7410:Rnf213	UTSW	11	119,325,877 (GRCm39)	missense
R7448:Rnf213	UTSW	11	119,372,117 (GRCm39)	missense
R7561:Rnf213	UTSW	11	119,332,545 (GRCm39)	missense
R7573:Rnf213	UTSW	11	119,349,310 (GRCm39)	missense
R7615:Rnf213	UTSW	11	119,358,123 (GRCm39)	missense
R7680:Rnf213	UTSW	11	119,370,382 (GRCm39)	missense
R7739:Rnf213	UTSW	11	119,301,687 (GRCm39)	missense
R7789:Rnf213	UTSW	11	119,361,045 (GRCm39)	splice site	probably null
R7806:Rnf213	UTSW	11	119,302,371 (GRCm39)	missense
R8031:Rnf213	UTSW	11	119,321,107 (GRCm39)	nonsense	probably null
R8042:Rnf213	UTSW	11	119,332,480 (GRCm39)	missense
R8053:Rnf213	UTSW	11	119,293,473 (GRCm39)	missense
R8284:Rnf213	UTSW	11	119,318,909 (GRCm39)	missense
R8301:Rnf213	UTSW	11	119,325,568 (GRCm39)	missense
R8325:Rnf213	UTSW	11	119,321,271 (GRCm39)	missense
R8332:Rnf213	UTSW	11	119,374,524 (GRCm39)	missense
R8443:Rnf213	UTSW	11	119,340,149 (GRCm39)	missense
R8518:Rnf213	UTSW	11	119,353,043 (GRCm39)	missense
R8531:Rnf213	UTSW	11	119,365,031 (GRCm39)	missense	probably benign	0.02
R8670:Rnf213	UTSW	11	119,349,563 (GRCm39)	missense
R8675:Rnf213	UTSW	11	119,346,984 (GRCm39)	missense
R8690:Rnf213	UTSW	11	119,332,038 (GRCm39)	missense
R8690:Rnf213	UTSW	11	119,308,955 (GRCm39)	missense
R8714:Rnf213	UTSW	11	119,359,720 (GRCm39)	missense
R8802:Rnf213	UTSW	11	119,352,928 (GRCm39)	missense
R8861:Rnf213	UTSW	11	119,333,062 (GRCm39)	missense
R8886:Rnf213	UTSW	11	119,364,264 (GRCm39)	missense
R8893:Rnf213	UTSW	11	119,333,868 (GRCm39)	missense
R8937:Rnf213	UTSW	11	119,321,100 (GRCm39)	missense	possibly damaging	0.94
R8941:Rnf213	UTSW	11	119,305,250 (GRCm39)	missense	probably damaging	1.00
R8973:Rnf213	UTSW	11	119,352,756 (GRCm39)	missense
R8983:Rnf213	UTSW	11	119,321,175 (GRCm39)	missense
R9043:Rnf213	UTSW	11	119,349,739 (GRCm39)	missense
R9081:Rnf213	UTSW	11	119,357,062 (GRCm39)	missense
R9132:Rnf213	UTSW	11	119,374,742 (GRCm39)	missense
R9135:Rnf213	UTSW	11	119,299,573 (GRCm39)	missense
R9146:Rnf213	UTSW	11	119,334,499 (GRCm39)	missense
R9156:Rnf213	UTSW	11	119,331,574 (GRCm39)	missense
R9183:Rnf213	UTSW	11	119,318,448 (GRCm39)	missense
R9234:Rnf213	UTSW	11	119,340,943 (GRCm39)	missense
R9275:Rnf213	UTSW	11	119,326,768 (GRCm39)	missense
R9278:Rnf213	UTSW	11	119,326,768 (GRCm39)	missense
R9296:Rnf213	UTSW	11	119,334,621 (GRCm39)	splice site	probably benign
R9350:Rnf213	UTSW	11	119,332,975 (GRCm39)	missense
R9366:Rnf213	UTSW	11	119,327,057 (GRCm39)	missense
R9413:Rnf213	UTSW	11	119,357,059 (GRCm39)	missense
R9444:Rnf213	UTSW	11	119,325,623 (GRCm39)	missense
R9464:Rnf213	UTSW	11	119,354,406 (GRCm39)	missense
R9605:Rnf213	UTSW	11	119,359,879 (GRCm39)	missense
R9649:Rnf213	UTSW	11	119,370,457 (GRCm39)	missense
R9651:Rnf213	UTSW	11	119,331,238 (GRCm39)	missense
R9664:Rnf213	UTSW	11	119,332,794 (GRCm39)	missense
R9696:Rnf213	UTSW	11	119,359,806 (GRCm39)	missense
R9710:Rnf213	UTSW	11	119,331,831 (GRCm39)	missense
R9797:Rnf213	UTSW	11	119,333,365 (GRCm39)	missense
S24628:Rnf213	UTSW	11	119,305,295 (GRCm39)	missense	probably damaging	1.00
X0021:Rnf213	UTSW	11	119,332,650 (GRCm39)	missense	probably benign	0.14
X0062:Rnf213	UTSW	11	119,364,339 (GRCm39)	missense	probably benign	0.05
X0064:Rnf213	UTSW	11	119,331,289 (GRCm39)	missense	probably damaging	1.00
Z1088:Rnf213	UTSW	11	119,368,080 (GRCm39)	missense	possibly damaging	0.69
Z1176:Rnf213	UTSW	11	119,373,824 (GRCm39)	missense
Z1176:Rnf213	UTSW	11	119,332,236 (GRCm39)	missense

Predicted Primers

PCR Primer
(F):5'- ACCTGTTCAGACCATACAGGC -3'
(R):5'- TGACACAATTGAGACTGTGGG -3'

Sequencing Primer
(F):5'- TGTTCAGACCATACAGGCTGGAAC -3'
(R):5'- TGCAGTGCACTCTGGTGTCC -3'

Posted On

2016-03-17