Incidental Mutation 'R4895:Phip'
ID377576
Institutional Source Beutler Lab
Gene Symbol Phip
Ensembl Gene ENSMUSG00000032253
Gene Namepleckstrin homology domain interacting protein
SynonymsWdr11, 2810004D21Rik, 4632404O06Rik, Ndrp
MMRRC Submission 042499-MU
Accession Numbers

Genbank: NM_001081216; MGI: 1932404

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4895 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location82866159-82975516 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82959595 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 57 (V57A)
Ref Sequence ENSEMBL: ENSMUSP00000140445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034787] [ENSMUST00000189985]
Predicted Effect probably benign
Transcript: ENSMUST00000034787
AA Change: V119A

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000034787
Gene: ENSMUSG00000032253
AA Change: V119A

DomainStartEndE-ValueType
WD40 172 211 1.5e-8 SMART
WD40 214 253 4.1e-9 SMART
WD40 256 299 3.5e-7 SMART
WD40 310 349 1.4e-1 SMART
WD40 354 393 6.6e-10 SMART
WD40 408 452 1.4e-2 SMART
WD40 455 495 3.4e-10 SMART
WD40 498 542 6.6e-2 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 841 854 N/A INTRINSIC
low complexity region 865 877 N/A INTRINSIC
coiled coil region 881 907 N/A INTRINSIC
low complexity region 928 941 N/A INTRINSIC
BROMO 1158 1261 3.5e-11 SMART
BROMO 1318 1423 4.1e-30 SMART
low complexity region 1438 1463 N/A INTRINSIC
low complexity region 1500 1513 N/A INTRINSIC
low complexity region 1708 1721 N/A INTRINSIC
low complexity region 1752 1758 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187021
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188868
Predicted Effect probably benign
Transcript: ENSMUST00000189985
AA Change: V57A

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140445
Gene: ENSMUSG00000032253
AA Change: V57A

DomainStartEndE-ValueType
WD40 110 149 1.5e-8 SMART
WD40 152 191 4e-9 SMART
WD40 194 237 3.5e-7 SMART
WD40 248 287 1.4e-1 SMART
WD40 292 331 6.5e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190838
Meta Mutation Damage Score 0.274 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to the insulin receptor substrate 1 protein and regulates glucose transporter translocation in skeletal muscle cells. The encoded protein may also regulate growth and survival of pancreatic beta cells. Elevated copy number of this gene may be associated with melanoma severity and the encoded protein may promote melanoma metastasis in human patients. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit postnatal and premature lethality associated with reduced body size, small myocardial cells and hepatocytes, hypoglycemia, increased insulin sensitivity, and reduced cell growth. [provided by MGI curators]
Allele List at MGI

All alleles(34) : Gene trapped(34)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519P11Rik C A 2: 154,613,070 probably benign Het
Abat G A 16: 8,615,962 A392T probably benign Het
Abca14 G A 7: 120,247,349 probably null Het
Abcc6 A T 7: 45,980,990 L1282Q possibly damaging Het
Acss2 A G 2: 155,550,481 probably benign Het
Adgrf1 G T 17: 43,310,620 V583L probably benign Het
Aftph T C 11: 20,696,801 D825G probably damaging Het
Ahnak T C 19: 9,017,441 V5363A probably benign Het
Apba3 G A 10: 81,271,283 probably null Het
Asb13 T C 13: 3,643,589 Y116H probably damaging Het
Asb4 C A 6: 5,398,266 T77K probably damaging Het
Atp8b4 A T 2: 126,414,369 H223Q probably benign Het
Best1 A G 19: 9,992,771 L159P probably benign Het
Cacna1h A T 17: 25,389,422 M731K probably damaging Het
Catspere1 T A 1: 177,859,861 noncoding transcript Het
Cenpv A T 11: 62,527,520 Y202* probably null Het
Cep57 A T 9: 13,816,153 probably benign Het
Cfap100 T A 6: 90,406,102 D363V possibly damaging Het
Cluh A G 11: 74,667,405 Y1126C probably damaging Het
Cyp2j5 A G 4: 96,663,110 probably null Het
Dnajc11 T C 4: 151,979,933 F514L probably damaging Het
Efcab3 T A 11: 105,117,401 probably benign Het
Eif2b4 T G 5: 31,192,954 Q8P probably benign Het
Epha6 A T 16: 59,666,555 V1043E probably benign Het
Gm11562 G T 11: 99,620,315 Q20K unknown Het
Gm11639 C T 11: 104,720,286 T318I probably benign Het
Gm11639 A G 11: 104,749,670 D1026G probably damaging Het
Gm13762 A T 2: 88,973,711 F60Y probably benign Het
Gm14415 A T 2: 177,104,321 noncoding transcript Het
Gm5431 A G 11: 48,889,028 S634P probably damaging Het
Gpld1 C A 13: 24,979,728 N501K probably damaging Het
Gsn C T 2: 35,302,578 R513C probably damaging Het
Gulp1 T C 1: 44,788,597 F300L probably benign Het
H2afj T C 6: 136,808,662 V108A possibly damaging Het
Haus3 T C 5: 34,168,070 R82G probably benign Het
Herc2 G A 7: 56,222,986 R4424H probably damaging Het
Hmcn1 T A 1: 150,677,379 Q2520L probably benign Het
Hs2st1 T C 3: 144,465,253 I53V probably benign Het
Inpp5e C T 2: 26,397,912 R624Q probably damaging Het
Ints8 G T 4: 11,230,367 C491* probably null Het
Itpkb C A 1: 180,413,895 A710D probably damaging Het
Kcnk4 A C 19: 6,928,416 probably null Het
Kmt2d T C 15: 98,844,487 probably benign Het
Lamb3 C T 1: 193,332,314 R594* probably null Het
Map3k20 A G 2: 72,402,356 probably benign Het
Maz A T 7: 127,025,300 probably null Het
Mtr T C 13: 12,216,866 T651A probably benign Het
Nbeal1 A G 1: 60,292,903 E2252G probably damaging Het
Ndufa10 A G 1: 92,469,896 Y61H probably damaging Het
Npat T A 9: 53,570,489 L1166M probably damaging Het
Olfr1112 A C 2: 87,191,848 I54L probably benign Het
Olfr1447 C T 19: 12,900,887 V298M probably damaging Het
Olfr190 C T 16: 59,074,657 C141Y probably benign Het
Olfr490 A C 7: 108,286,595 I177S probably damaging Het
Olfr988 A T 2: 85,352,997 *310K probably null Het
Pcdhb3 T C 18: 37,301,706 F242L probably damaging Het
Plekha7 A T 7: 116,189,391 probably null Het
Pot1a A C 6: 25,753,206 F444V probably damaging Het
Ppm1a C T 12: 72,784,352 P217L probably damaging Het
Prepl A G 17: 85,081,066 F203S probably damaging Het
Prl8a1 T C 13: 27,575,530 I175V probably benign Het
Ranbp6 A T 19: 29,809,775 I1059N possibly damaging Het
Rhag A G 17: 40,811,351 Q59R probably benign Het
Sema4c A C 1: 36,553,570 probably null Het
Sf3b3 T C 8: 110,816,024 D902G probably benign Het
Tbc1d23 A G 16: 57,198,857 probably null Het
Tbrg1 A T 9: 37,655,079 I54N probably damaging Het
Tchh A T 3: 93,445,686 E811V unknown Het
Tenm3 T A 8: 48,300,971 D799V probably damaging Het
Tlr5 T C 1: 182,974,199 L342P probably damaging Het
Tppp C T 13: 74,030,877 R146* probably null Het
Trpm4 A T 7: 45,318,058 M574K probably damaging Het
Uggt1 A T 1: 36,156,264 F1288Y probably damaging Het
Uggt2 T A 14: 119,018,886 K1124N probably damaging Het
Usf3 A C 16: 44,221,096 S1980R possibly damaging Het
Vav2 T C 2: 27,318,961 D100G probably damaging Het
Vmn2r3 G T 3: 64,259,761 H650N probably benign Het
Vmn2r59 T A 7: 42,045,794 Y398F probably damaging Het
Zfp619 A G 7: 39,537,972 D1142G possibly damaging Het
Zfp933 G A 4: 147,826,435 R235* probably null Het
Other mutations in Phip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Phip APN 9 82871303 missense probably damaging 0.99
IGL01510:Phip APN 9 82913871 missense probably benign 0.01
IGL01916:Phip APN 9 82890469 missense possibly damaging 0.61
IGL02068:Phip APN 9 82945808 missense probably damaging 1.00
IGL02089:Phip APN 9 82871319 missense probably damaging 1.00
IGL02121:Phip APN 9 82893370 missense probably damaging 1.00
IGL02132:Phip APN 9 82881341 missense possibly damaging 0.91
IGL02146:Phip APN 9 82881718 missense probably benign 0.05
IGL02282:Phip APN 9 82913690 missense probably benign 0.09
IGL02341:Phip APN 9 82932883 missense probably damaging 1.00
IGL02342:Phip APN 9 82886692 missense probably damaging 1.00
IGL02470:Phip APN 9 82890454 missense possibly damaging 0.69
IGL02585:Phip APN 9 82903188 missense probably benign 0.03
IGL03271:Phip APN 9 82884824 splice site probably benign
3-1:Phip UTSW 9 82886671 missense probably damaging 1.00
R0102:Phip UTSW 9 82905792 splice site probably null
R0102:Phip UTSW 9 82905792 splice site probably null
R0137:Phip UTSW 9 82927191 splice site probably null
R0268:Phip UTSW 9 82871288 missense probably damaging 1.00
R0366:Phip UTSW 9 82926407 missense probably damaging 1.00
R0421:Phip UTSW 9 82926457 missense probably damaging 1.00
R0481:Phip UTSW 9 82876716 splice site probably benign
R0883:Phip UTSW 9 82876221 missense probably benign 0.01
R0885:Phip UTSW 9 82875395 missense probably benign 0.06
R1300:Phip UTSW 9 82876747 missense probably benign 0.00
R1434:Phip UTSW 9 82959605 missense probably damaging 0.99
R1448:Phip UTSW 9 82915423 missense possibly damaging 0.92
R1588:Phip UTSW 9 82900828 missense probably damaging 1.00
R1619:Phip UTSW 9 82871449 missense probably benign 0.20
R1658:Phip UTSW 9 82871498 missense probably benign
R1688:Phip UTSW 9 82871657 missense probably benign
R1773:Phip UTSW 9 82876189 missense probably benign
R1865:Phip UTSW 9 82945792 missense probably damaging 1.00
R1934:Phip UTSW 9 82903182 missense probably benign 0.11
R2070:Phip UTSW 9 82875299 missense probably benign
R2096:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2097:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2099:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2192:Phip UTSW 9 82871815 missense probably damaging 0.99
R2402:Phip UTSW 9 82875305 missense probably benign
R2447:Phip UTSW 9 82915399 missense probably damaging 0.99
R2504:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2507:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2508:Phip UTSW 9 82915339 missense possibly damaging 0.95
R3706:Phip UTSW 9 82900743 missense probably benign 0.02
R3829:Phip UTSW 9 82871645 missense probably benign
R3846:Phip UTSW 9 82876126 nonsense probably null
R4301:Phip UTSW 9 82959713 nonsense probably null
R4366:Phip UTSW 9 82900869 intron probably benign
R4748:Phip UTSW 9 82908869 missense probably benign 0.01
R5001:Phip UTSW 9 82896019 splice site probably null
R5094:Phip UTSW 9 82871844 missense probably benign
R5181:Phip UTSW 9 82871190 utr 3 prime probably benign
R5194:Phip UTSW 9 82908862 missense probably benign 0.03
R5291:Phip UTSW 9 82945883 missense probably damaging 1.00
R5335:Phip UTSW 9 82900756 missense possibly damaging 0.93
R5458:Phip UTSW 9 82926500 missense probably benign 0.40
R5704:Phip UTSW 9 82871355 missense probably damaging 0.97
R5866:Phip UTSW 9 82890150 missense probably benign
R5870:Phip UTSW 9 82908677 splice site probably benign
R5890:Phip UTSW 9 82906952 missense probably benign 0.00
R6232:Phip UTSW 9 82903181 missense probably benign
R6379:Phip UTSW 9 82913857 missense probably damaging 0.98
R6653:Phip UTSW 9 82900741 nonsense probably null
R7129:Phip UTSW 9 82877300 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTGAGAGGTTTCCATCTTTGAATG -3'
(R):5'- AATTCCTCAGAGTGTTCCTGG -3'

Sequencing Primer
(F):5'- TCTTTACCCAGAGGACATC -3'
(R):5'- AATTCCTCAGAGTGTTCCTGGAGTAC -3'
Posted On2016-03-17