Incidental Mutation 'R4895:Mtr'
ID377588
Institutional Source Beutler Lab
Gene Symbol Mtr
Ensembl Gene ENSMUSG00000021311
Gene Name5-methyltetrahydrofolate-homocysteine methyltransferase
Synonymsmethionine synthase, D830038K18Rik, MS
MMRRC Submission 042499-MU
Accession Numbers

Genbank: NM_001081128

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4895 (G1)
Quality Score204
Status Validated
Chromosome13
Chromosomal Location12182712-12258113 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12216866 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 651 (T651A)
Ref Sequence ENSEMBL: ENSMUSP00000097442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099856] [ENSMUST00000221290]
Predicted Effect probably benign
Transcript: ENSMUST00000099856
AA Change: T651A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000097442
Gene: ENSMUSG00000021311
AA Change: T651A

DomainStartEndE-ValueType
Pfam:S-methyl_trans 18 326 1.5e-93 PFAM
Pfam:Pterin_bind 363 601 4.6e-63 PFAM
B12-binding_2 657 743 6.42e-41 SMART
Pfam:B12-binding 761 861 3.3e-20 PFAM
Pfam:Met_synt_B12 953 1234 2.5e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221290
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 5-methyltetrahydrofolate-homocysteine methyltransferase. This enzyme, also known as cobalamin-dependent methionine synthase, catalyzes the final step in methionine biosynthesis. Mutations in MTR have been identified as the underlying cause of methylcobalamin deficiency complementation group G. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit embryonic lethality prior to E9.5. Heterozygous appear mostly similar to conrtols, except that they exhibit elevated plasma methionine and homocysteine levels. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Gene trapped(5)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519P11Rik C A 2: 154,613,070 probably benign Het
Abat G A 16: 8,615,962 A392T probably benign Het
Abca14 G A 7: 120,247,349 probably null Het
Abcc6 A T 7: 45,980,990 L1282Q possibly damaging Het
Acss2 A G 2: 155,550,481 probably benign Het
Adgrf1 G T 17: 43,310,620 V583L probably benign Het
Aftph T C 11: 20,696,801 D825G probably damaging Het
Ahnak T C 19: 9,017,441 V5363A probably benign Het
Apba3 G A 10: 81,271,283 probably null Het
Asb13 T C 13: 3,643,589 Y116H probably damaging Het
Asb4 C A 6: 5,398,266 T77K probably damaging Het
Atp8b4 A T 2: 126,414,369 H223Q probably benign Het
Best1 A G 19: 9,992,771 L159P probably benign Het
Cacna1h A T 17: 25,389,422 M731K probably damaging Het
Catspere1 T A 1: 177,859,861 noncoding transcript Het
Cenpv A T 11: 62,527,520 Y202* probably null Het
Cep57 A T 9: 13,816,153 probably benign Het
Cfap100 T A 6: 90,406,102 D363V possibly damaging Het
Cluh A G 11: 74,667,405 Y1126C probably damaging Het
Cyp2j5 A G 4: 96,663,110 probably null Het
Dnajc11 T C 4: 151,979,933 F514L probably damaging Het
Efcab3 T A 11: 105,117,401 probably benign Het
Eif2b4 T G 5: 31,192,954 Q8P probably benign Het
Epha6 A T 16: 59,666,555 V1043E probably benign Het
Gm11562 G T 11: 99,620,315 Q20K unknown Het
Gm11639 C T 11: 104,720,286 T318I probably benign Het
Gm11639 A G 11: 104,749,670 D1026G probably damaging Het
Gm13762 A T 2: 88,973,711 F60Y probably benign Het
Gm14415 A T 2: 177,104,321 noncoding transcript Het
Gm5431 A G 11: 48,889,028 S634P probably damaging Het
Gpld1 C A 13: 24,979,728 N501K probably damaging Het
Gsn C T 2: 35,302,578 R513C probably damaging Het
Gulp1 T C 1: 44,788,597 F300L probably benign Het
H2afj T C 6: 136,808,662 V108A possibly damaging Het
Haus3 T C 5: 34,168,070 R82G probably benign Het
Herc2 G A 7: 56,222,986 R4424H probably damaging Het
Hmcn1 T A 1: 150,677,379 Q2520L probably benign Het
Hs2st1 T C 3: 144,465,253 I53V probably benign Het
Inpp5e C T 2: 26,397,912 R624Q probably damaging Het
Ints8 G T 4: 11,230,367 C491* probably null Het
Itpkb C A 1: 180,413,895 A710D probably damaging Het
Kcnk4 A C 19: 6,928,416 probably null Het
Kmt2d T C 15: 98,844,487 probably benign Het
Lamb3 C T 1: 193,332,314 R594* probably null Het
Map3k20 A G 2: 72,402,356 probably benign Het
Maz A T 7: 127,025,300 probably null Het
Nbeal1 A G 1: 60,292,903 E2252G probably damaging Het
Ndufa10 A G 1: 92,469,896 Y61H probably damaging Het
Npat T A 9: 53,570,489 L1166M probably damaging Het
Olfr1112 A C 2: 87,191,848 I54L probably benign Het
Olfr1447 C T 19: 12,900,887 V298M probably damaging Het
Olfr190 C T 16: 59,074,657 C141Y probably benign Het
Olfr490 A C 7: 108,286,595 I177S probably damaging Het
Olfr988 A T 2: 85,352,997 *310K probably null Het
Pcdhb3 T C 18: 37,301,706 F242L probably damaging Het
Phip A G 9: 82,959,595 V57A probably benign Het
Plekha7 A T 7: 116,189,391 probably null Het
Pot1a A C 6: 25,753,206 F444V probably damaging Het
Ppm1a C T 12: 72,784,352 P217L probably damaging Het
Prepl A G 17: 85,081,066 F203S probably damaging Het
Prl8a1 T C 13: 27,575,530 I175V probably benign Het
Ranbp6 A T 19: 29,809,775 I1059N possibly damaging Het
Rhag A G 17: 40,811,351 Q59R probably benign Het
Sema4c A C 1: 36,553,570 probably null Het
Sf3b3 T C 8: 110,816,024 D902G probably benign Het
Tbc1d23 A G 16: 57,198,857 probably null Het
Tbrg1 A T 9: 37,655,079 I54N probably damaging Het
Tchh A T 3: 93,445,686 E811V unknown Het
Tenm3 T A 8: 48,300,971 D799V probably damaging Het
Tlr5 T C 1: 182,974,199 L342P probably damaging Het
Tppp C T 13: 74,030,877 R146* probably null Het
Trpm4 A T 7: 45,318,058 M574K probably damaging Het
Uggt1 A T 1: 36,156,264 F1288Y probably damaging Het
Uggt2 T A 14: 119,018,886 K1124N probably damaging Het
Usf3 A C 16: 44,221,096 S1980R possibly damaging Het
Vav2 T C 2: 27,318,961 D100G probably damaging Het
Vmn2r3 G T 3: 64,259,761 H650N probably benign Het
Vmn2r59 T A 7: 42,045,794 Y398F probably damaging Het
Zfp619 A G 7: 39,537,972 D1142G possibly damaging Het
Zfp933 G A 4: 147,826,435 R235* probably null Het
Other mutations in Mtr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Mtr APN 13 12225650 splice site probably benign
IGL02456:Mtr APN 13 12199094 missense probably damaging 0.98
IGL02573:Mtr APN 13 12199127 missense possibly damaging 0.95
IGL02642:Mtr APN 13 12195232 splice site probably benign
IGL03005:Mtr APN 13 12235449 splice site probably benign
IGL03017:Mtr APN 13 12247891 critical splice donor site probably null
IGL03036:Mtr APN 13 12247377 missense probably damaging 1.00
H8930:Mtr UTSW 13 12235460 missense probably damaging 1.00
PIT4431001:Mtr UTSW 13 12212443 missense probably damaging 1.00
PIT4520001:Mtr UTSW 13 12197985 nonsense probably null
R0011:Mtr UTSW 13 12238052 splice site probably benign
R0047:Mtr UTSW 13 12222226 missense probably damaging 1.00
R0047:Mtr UTSW 13 12222226 missense probably damaging 1.00
R0304:Mtr UTSW 13 12222154 critical splice donor site probably null
R0617:Mtr UTSW 13 12221432 missense probably benign
R0842:Mtr UTSW 13 12200247 missense probably damaging 1.00
R1101:Mtr UTSW 13 12189525 missense possibly damaging 0.84
R1450:Mtr UTSW 13 12193733 missense probably damaging 0.99
R1534:Mtr UTSW 13 12235544 splice site probably benign
R1907:Mtr UTSW 13 12225532 missense probably damaging 1.00
R2111:Mtr UTSW 13 12244601 missense possibly damaging 0.86
R2354:Mtr UTSW 13 12188157 splice site probably benign
R3849:Mtr UTSW 13 12247365 missense probably benign 0.16
R3899:Mtr UTSW 13 12216849 missense probably benign 0.00
R4012:Mtr UTSW 13 12189397 missense probably damaging 1.00
R4012:Mtr UTSW 13 12189398 missense probably damaging 1.00
R4075:Mtr UTSW 13 12215412 critical splice donor site probably null
R4091:Mtr UTSW 13 12231057 missense probably damaging 1.00
R4655:Mtr UTSW 13 12227793 missense probably damaging 1.00
R4801:Mtr UTSW 13 12195251 missense probably benign 0.01
R4802:Mtr UTSW 13 12195251 missense probably benign 0.01
R5481:Mtr UTSW 13 12188155 critical splice acceptor site probably null
R5966:Mtr UTSW 13 12215567 critical splice acceptor site probably null
R6209:Mtr UTSW 13 12190392 missense probably benign 0.00
R6348:Mtr UTSW 13 12247954 missense possibly damaging 0.49
R6463:Mtr UTSW 13 12216866 missense probably benign 0.01
R6467:Mtr UTSW 13 12188106 missense probably damaging 1.00
R7046:Mtr UTSW 13 12190209 missense possibly damaging 0.58
X0064:Mtr UTSW 13 12250657 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCCACACCCATCTATGAAG -3'
(R):5'- TGACTTCAGTCTTGATCCATGC -3'

Sequencing Primer
(F):5'- GACAGGCATCTCAGGTTAAAAATC -3'
(R):5'- AGTCTTGATCCATGCTGAACAC -3'
Posted On2016-03-17