Incidental Mutation 'R4896:Add2'
ID377633
Institutional Source Beutler Lab
Gene Symbol Add2
Ensembl Gene ENSMUSG00000030000
Gene Nameadducin 2 (beta)
Synonyms
MMRRC Submission 042500-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #R4896 (G1)
Quality Score224
Status Validated
Chromosome6
Chromosomal Location86028681-86124409 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86096746 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 206 (T206A)
Ref Sequence ENSEMBL: ENSMUSP00000145034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032069] [ENSMUST00000203196] [ENSMUST00000203279] [ENSMUST00000203366] [ENSMUST00000203445] [ENSMUST00000203724] [ENSMUST00000203786] [ENSMUST00000204059] [ENSMUST00000205034]
Predicted Effect probably benign
Transcript: ENSMUST00000032069
AA Change: T206A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000032069
Gene: ENSMUSG00000030000
AA Change: T206A

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
coiled coil region 558 585 N/A INTRINSIC
low complexity region 687 725 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203196
AA Change: T206A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000145104
Gene: ENSMUSG00000030000
AA Change: T206A

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203279
AA Change: T206A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000145452
Gene: ENSMUSG00000030000
AA Change: T206A

DomainStartEndE-ValueType
Aldolase_II 135 289 1.77e-20 SMART
coiled coil region 310 337 N/A INTRINSIC
low complexity region 439 477 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203366
AA Change: T206A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000144849
Gene: ENSMUSG00000030000
AA Change: T206A

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203445
SMART Domains Protein: ENSMUSP00000145494
Gene: ENSMUSG00000030000

DomainStartEndE-ValueType
Pfam:Aldolase_II 135 184 7.3e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203529
Predicted Effect probably benign
Transcript: ENSMUST00000203724
AA Change: T206A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000145296
Gene: ENSMUSG00000030000
AA Change: T206A

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
coiled coil region 558 585 N/A INTRINSIC
low complexity region 687 725 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203786
AA Change: T206A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000144694
Gene: ENSMUSG00000030000
AA Change: T206A

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
coiled coil region 558 585 N/A INTRINSIC
low complexity region 687 725 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204059
AA Change: T206A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000145160
Gene: ENSMUSG00000030000
AA Change: T206A

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
coiled coil region 558 585 N/A INTRINSIC
low complexity region 687 725 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205034
AA Change: T206A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000145034
Gene: ENSMUSG00000030000
AA Change: T206A

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
Meta Mutation Damage Score 0.072 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 99% (101/102)
MGI Phenotype FUNCTION: This gene encodes the beta subunit of the adducin family. Adducins, encoded by alpha, beta and gamma genes, are heteromeric proteins that crosslink actin filaments with spectrin at the cytoskeletal membrane. This protein, primarily found in the brain and hematopoietic cells, is regulated by phosphorylation and calmodulin interactions as it promotes spectrin assembly onto actin filaments, bundles actin and caps barbed ends of actin filaments. In mouse, deficiency of this gene can lead to mild hemolytic anemia and impaired synaptic plasticity. Mutations of this gene in mouse serve as a pathophysiological model for hereditary spherocytosis and hereditary elliptocytosis. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display mild anemia with compensated hemolysis, marked alteration in osmotic fragility, predominant presence of elliptocytes in the blood and increased blood pressure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,937 S1898P probably benign Het
4932438A13Rik T G 3: 36,965,937 N2108K probably damaging Het
Abcb4 T C 5: 8,907,267 V132A possibly damaging Het
Acpp A T 9: 104,306,975 V292E probably damaging Het
Adamts10 T C 17: 33,528,896 V102A possibly damaging Het
Alg12 A T 15: 88,816,188 L15Q probably damaging Het
Ankrd27 T A 7: 35,608,375 D346E probably damaging Het
Armc2 A T 10: 41,923,794 N689K probably damaging Het
Best3 T A 10: 117,024,555 D573E probably benign Het
Ccdc80 A T 16: 45,095,898 Q339L probably benign Het
Cdh9 T C 15: 16,778,156 V19A probably benign Het
Cnksr1 A T 4: 134,229,675 probably null Het
Col7a1 T A 9: 108,957,277 V525E unknown Het
Crebrf T C 17: 26,742,420 S172P possibly damaging Het
Csmd1 T C 8: 16,009,439 I2099V probably benign Het
Dcaf4 T A 12: 83,539,459 M400K possibly damaging Het
Dnah11 A T 12: 117,995,200 F2983I probably damaging Het
Dock6 A G 9: 21,824,437 V1005A possibly damaging Het
Dyrk2 C A 10: 118,868,248 G34C probably damaging Het
Eif4a1 A T 11: 69,668,597 probably benign Het
Eno4 G T 19: 58,964,543 D330Y probably damaging Het
Faf1 G A 4: 109,842,299 C347Y probably benign Het
Fam169a A G 13: 97,097,592 Y124C probably damaging Het
Fam227a G T 15: 79,637,054 F269L probably benign Het
Fam60a A G 6: 148,933,000 probably null Het
Fancm C A 12: 65,075,831 D42E probably damaging Het
Fat1 T A 8: 44,951,280 I356N possibly damaging Het
Fer1l6 A T 15: 58,638,020 T1444S probably damaging Het
Galr1 A G 18: 82,393,940 L267P probably damaging Het
Gbx1 T C 5: 24,504,839 H336R probably damaging Het
Gimap8 A T 6: 48,659,347 Q682L possibly damaging Het
Gm2396 T G 9: 88,931,228 noncoding transcript Het
Gm5798 T C 14: 41,348,657 L8S probably damaging Het
Hmgcll1 C T 9: 76,056,178 S39F possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Il3ra A T 14: 14,355,381 E289D probably benign Het
Isoc1 T A 18: 58,673,278 L220Q probably damaging Het
Itga2 T A 13: 114,853,766 K918* probably null Het
Kat6a C T 8: 22,938,313 T1228I probably benign Het
Klhl30 T A 1: 91,359,324 probably null Het
Krtap6-2 A T 16: 89,419,918 C54S unknown Het
Lmf2 G A 15: 89,351,800 P634S probably benign Het
Map3k4 A G 17: 12,272,019 V175A possibly damaging Het
Mcm3 A C 1: 20,820,256 probably benign Het
Mon1b T C 8: 113,639,227 S396P probably damaging Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Ncor2 A G 5: 125,049,340 probably null Het
Nlrc5 T G 8: 94,521,216 probably benign Het
Nlrp14 GT GTT 7: 107,197,179 probably null Het
Nwd2 T G 5: 63,804,808 S578R probably damaging Het
Odf3 G A 7: 140,848,485 probably benign Het
Olfr1289 G A 2: 111,483,660 V105I possibly damaging Het
Olfr360 A G 2: 37,068,410 Y35C probably damaging Het
Otoa C A 7: 121,102,679 P194T probably damaging Het
Pde1b A C 15: 103,521,374 D98A probably damaging Het
Pi4ka A T 16: 17,377,169 C122S probably damaging Het
Pole2 C T 12: 69,223,150 V67M probably damaging Het
Prickle2 A T 6: 92,416,755 D312E probably benign Het
Prkd1 T C 12: 50,389,962 D453G probably damaging Het
Prrc1 T A 18: 57,374,554 V260E probably damaging Het
Reg3g A T 6: 78,467,810 Y62N probably benign Het
Reln C T 5: 21,955,238 G2111E probably damaging Het
Rsph6a A T 7: 19,057,740 E278V possibly damaging Het
Scpep1 T A 11: 88,941,296 I203F probably damaging Het
Sec24d T C 3: 123,354,947 C747R probably damaging Het
Sec31a A T 5: 100,368,333 N967K probably damaging Het
Sell T C 1: 164,063,062 W5R probably benign Het
Siglec1 C T 2: 131,069,869 V1697M probably benign Het
Slc22a26 T A 19: 7,791,054 I213L probably benign Het
Slc2a13 G A 15: 91,412,212 P300S probably benign Het
Slco1a4 A G 6: 141,815,505 Y461H possibly damaging Het
Slco3a1 G C 7: 74,320,556 C434W probably null Het
Sp3 A T 2: 72,938,289 V666D probably benign Het
Spidr A T 16: 16,118,942 W100R possibly damaging Het
Stk33 T A 7: 109,327,595 M286L probably damaging Het
Sult1c2 T A 17: 53,832,135 I183F probably benign Het
Svep1 G T 4: 58,087,751 T1776K probably benign Het
Tesk2 A G 4: 116,802,993 H436R probably benign Het
Tex2 T C 11: 106,568,404 T67A probably damaging Het
Timm10 T C 2: 84,829,848 S44P possibly damaging Het
Tmed11 C A 5: 108,795,182 probably null Het
Trim12c G A 7: 104,340,948 R441C probably damaging Het
Trmt2a A G 16: 18,252,929 K509E probably damaging Het
Upk3a A G 15: 85,019,423 T108A probably benign Het
Usp29 A G 7: 6,962,159 M334V probably benign Het
Vash1 A G 12: 86,680,142 D52G probably benign Het
Vmn2r14 T G 5: 109,220,380 T249P probably benign Het
Vmn2r43 A T 7: 8,244,849 F772I probably damaging Het
Vmn2r75 G T 7: 86,171,579 S49Y probably benign Het
Xdh T C 17: 73,910,243 T677A probably damaging Het
Zan A G 5: 137,386,456 L5102P unknown Het
Zfp160 T A 17: 21,020,081 S9T probably benign Het
Zfp273 A T 13: 67,825,554 H267L probably damaging Het
Zfp97 T A 17: 17,144,776 I179K probably benign Het
Zfp975 T C 7: 42,662,292 Y299C probably damaging Het
Other mutations in Add2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02689:Add2 APN 6 86107406 missense possibly damaging 0.94
IGL02799:Add2 UTSW 6 86106252 missense possibly damaging 0.65
R0012:Add2 UTSW 6 86098628 missense probably damaging 0.98
R0448:Add2 UTSW 6 86092919 missense probably benign 0.05
R0452:Add2 UTSW 6 86104629 nonsense probably null
R0834:Add2 UTSW 6 86086917 missense probably damaging 0.99
R1220:Add2 UTSW 6 86087000 missense possibly damaging 0.92
R1598:Add2 UTSW 6 86098646 missense probably benign 0.03
R1806:Add2 UTSW 6 86118657 missense probably damaging 0.96
R1837:Add2 UTSW 6 86118558 missense probably damaging 1.00
R1959:Add2 UTSW 6 86096756 missense probably damaging 1.00
R1961:Add2 UTSW 6 86096756 missense probably damaging 1.00
R2152:Add2 UTSW 6 86098598 missense probably damaging 1.00
R2309:Add2 UTSW 6 86096801 missense probably damaging 1.00
R4744:Add2 UTSW 6 86110888 missense probably damaging 1.00
R4789:Add2 UTSW 6 86118770 missense probably benign 0.04
R4989:Add2 UTSW 6 86110858 missense probably benign 0.10
R5004:Add2 UTSW 6 86096746 missense probably benign 0.03
R5061:Add2 UTSW 6 86087047 splice site probably null
R5068:Add2 UTSW 6 86107458 missense probably damaging 0.97
R5405:Add2 UTSW 6 86101197 missense probably benign 0.09
R5418:Add2 UTSW 6 86110912 missense probably benign 0.00
R5576:Add2 UTSW 6 86107475 critical splice donor site probably null
R5952:Add2 UTSW 6 86109746 missense probably damaging 1.00
R6011:Add2 UTSW 6 86098625 missense probably damaging 1.00
R6031:Add2 UTSW 6 86098673 missense probably damaging 1.00
R6031:Add2 UTSW 6 86098673 missense probably damaging 1.00
Z1088:Add2 UTSW 6 86085965 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCTTAGGACTCACCACAGG -3'
(R):5'- TGACATGGCTATACTCCAGATGATATC -3'

Sequencing Primer
(F):5'- AGGACTCCCTGTTGCTGTAC -3'
(R):5'- TATCTGCTCAGGGAGAAACTTAGGC -3'
Posted On2016-03-17