Incidental Mutation 'R4896:Col7a1'
ID377658
Institutional Source Beutler Lab
Gene Symbol Col7a1
Ensembl Gene ENSMUSG00000025650
Gene Namecollagen, type VII, alpha 1
Synonyms
MMRRC Submission 042500-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4896 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108953586-108984875 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108957277 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 525 (V525E)
Ref Sequence ENSEMBL: ENSMUSP00000107701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026740] [ENSMUST00000112070]
Predicted Effect unknown
Transcript: ENSMUST00000026740
AA Change: V525E
SMART Domains Protein: ENSMUSP00000026740
Gene: ENSMUSG00000025650
AA Change: V525E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
VWA 37 217 1.56e-51 SMART
FN3 233 319 1.41e-10 SMART
FN3 325 405 6.54e-6 SMART
FN3 416 494 6.91e-5 SMART
FN3 509 585 1.24e-6 SMART
FN3 599 675 2.01e-6 SMART
FN3 687 763 7.45e-10 SMART
FN3 774 854 6.01e-5 SMART
FN3 865 944 7.23e-8 SMART
FN3 955 1038 2.16e-6 SMART
Pfam:VWA 1055 1227 2.3e-22 PFAM
Pfam:Collagen 1244 1311 2.4e-8 PFAM
Pfam:Collagen 1294 1355 4.1e-10 PFAM
low complexity region 1397 1414 N/A INTRINSIC
Pfam:Collagen 1447 1504 1.3e-9 PFAM
Pfam:Collagen 1487 1547 5e-8 PFAM
low complexity region 1572 1595 N/A INTRINSIC
low complexity region 1604 1632 N/A INTRINSIC
Pfam:Collagen 1646 1714 2.8e-10 PFAM
Pfam:Collagen 1713 1775 1.9e-10 PFAM
low complexity region 1776 1794 N/A INTRINSIC
low complexity region 1803 1833 N/A INTRINSIC
Pfam:Collagen 1875 1935 1.5e-8 PFAM
Pfam:Collagen 1969 2033 2.4e-9 PFAM
Pfam:Collagen 2025 2092 9.1e-10 PFAM
Pfam:Collagen 2089 2158 1.3e-10 PFAM
Pfam:Collagen 2147 2209 1.6e-9 PFAM
Pfam:Collagen 2245 2312 1.4e-8 PFAM
Pfam:Collagen 2313 2365 2.5e-8 PFAM
Pfam:Collagen 2364 2423 7.3e-10 PFAM
Pfam:Collagen 2398 2457 1.5e-9 PFAM
Pfam:Collagen 2456 2515 8.4e-11 PFAM
Pfam:Collagen 2516 2572 1.9e-9 PFAM
Pfam:Collagen 2560 2630 7.2e-9 PFAM
Pfam:Collagen 2605 2682 6e-9 PFAM
Pfam:Collagen 2659 2722 2e-8 PFAM
low complexity region 2745 2775 N/A INTRINSIC
Pfam:Kunitz_BPTI 2878 2932 3.2e-19 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000112070
AA Change: V525E
SMART Domains Protein: ENSMUSP00000107701
Gene: ENSMUSG00000025650
AA Change: V525E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
VWA 37 217 1.56e-51 SMART
FN3 233 319 1.41e-10 SMART
FN3 325 405 6.54e-6 SMART
FN3 416 494 6.91e-5 SMART
FN3 509 585 1.24e-6 SMART
FN3 599 675 2.01e-6 SMART
FN3 687 763 7.45e-10 SMART
FN3 774 854 6.01e-5 SMART
FN3 865 944 7.23e-8 SMART
FN3 955 1038 2.16e-6 SMART
Pfam:VWA 1055 1230 2.2e-19 PFAM
Pfam:Collagen 1244 1311 2.5e-8 PFAM
Pfam:Collagen 1294 1355 4.2e-10 PFAM
low complexity region 1397 1414 N/A INTRINSIC
Pfam:Collagen 1447 1504 1.3e-9 PFAM
Pfam:Collagen 1487 1547 5.1e-8 PFAM
low complexity region 1572 1595 N/A INTRINSIC
low complexity region 1604 1632 N/A INTRINSIC
Pfam:Collagen 1646 1714 2.9e-10 PFAM
Pfam:Collagen 1713 1775 1.9e-10 PFAM
low complexity region 1776 1794 N/A INTRINSIC
low complexity region 1803 1833 N/A INTRINSIC
Pfam:Collagen 1875 1935 1.5e-8 PFAM
Pfam:Collagen 1969 2033 2.5e-9 PFAM
Pfam:Collagen 2025 2092 9.4e-10 PFAM
Pfam:Collagen 2089 2158 1.3e-10 PFAM
Pfam:Collagen 2147 2209 1.6e-9 PFAM
Pfam:Collagen 2195 2266 7.7e-7 PFAM
Pfam:Collagen 2245 2312 1.4e-8 PFAM
Pfam:Collagen 2313 2365 2.6e-8 PFAM
Pfam:Collagen 2364 2423 7.6e-10 PFAM
Pfam:Collagen 2398 2457 1.5e-9 PFAM
Pfam:Collagen 2456 2515 8.7e-11 PFAM
Pfam:Collagen 2516 2572 2e-9 PFAM
Pfam:Collagen 2560 2630 7.4e-9 PFAM
Pfam:Collagen 2605 2682 6.2e-9 PFAM
Pfam:Collagen 2659 2722 2.1e-8 PFAM
Pfam:Collagen 2719 2778 1.6e-7 PFAM
Pfam:Kunitz_BPTI 2878 2932 1.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192424
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 99% (101/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type VII collagen. The type VII collagen fibril, composed of three identical alpha collagen chains, is restricted to the basement zone beneath stratified squamous epithelia. It functions as an anchoring fibril between the external epithelia and the underlying stroma. Mutations in this gene are associated with all forms of dystrophic epidermolysis bullosa. In the absence of mutations, however, an acquired form of this disease can result from an autoimmune response made to type VII collagen. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are unable to reproduce and display postnatal growth retardation, blisters and erosion at sites of trauma, nonpigmented hair growth associated with hair loss, subepidermal blistering associated with poorly formed hemidesmosomes, and high postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,937 S1898P probably benign Het
4932438A13Rik T G 3: 36,965,937 N2108K probably damaging Het
Abcb4 T C 5: 8,907,267 V132A possibly damaging Het
Acpp A T 9: 104,306,975 V292E probably damaging Het
Adamts10 T C 17: 33,528,896 V102A possibly damaging Het
Add2 A G 6: 86,096,746 T206A probably benign Het
Alg12 A T 15: 88,816,188 L15Q probably damaging Het
Ankrd27 T A 7: 35,608,375 D346E probably damaging Het
Armc2 A T 10: 41,923,794 N689K probably damaging Het
Best3 T A 10: 117,024,555 D573E probably benign Het
Ccdc80 A T 16: 45,095,898 Q339L probably benign Het
Cdh9 T C 15: 16,778,156 V19A probably benign Het
Cnksr1 A T 4: 134,229,675 probably null Het
Crebrf T C 17: 26,742,420 S172P possibly damaging Het
Csmd1 T C 8: 16,009,439 I2099V probably benign Het
Dcaf4 T A 12: 83,539,459 M400K possibly damaging Het
Dnah11 A T 12: 117,995,200 F2983I probably damaging Het
Dock6 A G 9: 21,824,437 V1005A possibly damaging Het
Dyrk2 C A 10: 118,868,248 G34C probably damaging Het
Eif4a1 A T 11: 69,668,597 probably benign Het
Eno4 G T 19: 58,964,543 D330Y probably damaging Het
Faf1 G A 4: 109,842,299 C347Y probably benign Het
Fam169a A G 13: 97,097,592 Y124C probably damaging Het
Fam227a G T 15: 79,637,054 F269L probably benign Het
Fam60a A G 6: 148,933,000 probably null Het
Fancm C A 12: 65,075,831 D42E probably damaging Het
Fat1 T A 8: 44,951,280 I356N possibly damaging Het
Fer1l6 A T 15: 58,638,020 T1444S probably damaging Het
Galr1 A G 18: 82,393,940 L267P probably damaging Het
Gbx1 T C 5: 24,504,839 H336R probably damaging Het
Gimap8 A T 6: 48,659,347 Q682L possibly damaging Het
Gm2396 T G 9: 88,931,228 noncoding transcript Het
Gm5798 T C 14: 41,348,657 L8S probably damaging Het
Hmgcll1 C T 9: 76,056,178 S39F possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Il3ra A T 14: 14,355,381 E289D probably benign Het
Isoc1 T A 18: 58,673,278 L220Q probably damaging Het
Itga2 T A 13: 114,853,766 K918* probably null Het
Kat6a C T 8: 22,938,313 T1228I probably benign Het
Klhl30 T A 1: 91,359,324 probably null Het
Krtap6-2 A T 16: 89,419,918 C54S unknown Het
Lmf2 G A 15: 89,351,800 P634S probably benign Het
Map3k4 A G 17: 12,272,019 V175A possibly damaging Het
Mcm3 A C 1: 20,820,256 probably benign Het
Mon1b T C 8: 113,639,227 S396P probably damaging Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Ncor2 A G 5: 125,049,340 probably null Het
Nlrc5 T G 8: 94,521,216 probably benign Het
Nlrp14 GT GTT 7: 107,197,179 probably null Het
Nwd2 T G 5: 63,804,808 S578R probably damaging Het
Odf3 G A 7: 140,848,485 probably benign Het
Olfr1289 G A 2: 111,483,660 V105I possibly damaging Het
Olfr360 A G 2: 37,068,410 Y35C probably damaging Het
Otoa C A 7: 121,102,679 P194T probably damaging Het
Pde1b A C 15: 103,521,374 D98A probably damaging Het
Pi4ka A T 16: 17,377,169 C122S probably damaging Het
Pole2 C T 12: 69,223,150 V67M probably damaging Het
Prickle2 A T 6: 92,416,755 D312E probably benign Het
Prkd1 T C 12: 50,389,962 D453G probably damaging Het
Prrc1 T A 18: 57,374,554 V260E probably damaging Het
Reg3g A T 6: 78,467,810 Y62N probably benign Het
Reln C T 5: 21,955,238 G2111E probably damaging Het
Rsph6a A T 7: 19,057,740 E278V possibly damaging Het
Scpep1 T A 11: 88,941,296 I203F probably damaging Het
Sec24d T C 3: 123,354,947 C747R probably damaging Het
Sec31a A T 5: 100,368,333 N967K probably damaging Het
Sell T C 1: 164,063,062 W5R probably benign Het
Siglec1 C T 2: 131,069,869 V1697M probably benign Het
Slc22a26 T A 19: 7,791,054 I213L probably benign Het
Slc2a13 G A 15: 91,412,212 P300S probably benign Het
Slco1a4 A G 6: 141,815,505 Y461H possibly damaging Het
Slco3a1 G C 7: 74,320,556 C434W probably null Het
Sp3 A T 2: 72,938,289 V666D probably benign Het
Spidr A T 16: 16,118,942 W100R possibly damaging Het
Stk33 T A 7: 109,327,595 M286L probably damaging Het
Sult1c2 T A 17: 53,832,135 I183F probably benign Het
Svep1 G T 4: 58,087,751 T1776K probably benign Het
Tesk2 A G 4: 116,802,993 H436R probably benign Het
Tex2 T C 11: 106,568,404 T67A probably damaging Het
Timm10 T C 2: 84,829,848 S44P possibly damaging Het
Tmed11 C A 5: 108,795,182 probably null Het
Trim12c G A 7: 104,340,948 R441C probably damaging Het
Trmt2a A G 16: 18,252,929 K509E probably damaging Het
Upk3a A G 15: 85,019,423 T108A probably benign Het
Usp29 A G 7: 6,962,159 M334V probably benign Het
Vash1 A G 12: 86,680,142 D52G probably benign Het
Vmn2r14 T G 5: 109,220,380 T249P probably benign Het
Vmn2r43 A T 7: 8,244,849 F772I probably damaging Het
Vmn2r75 G T 7: 86,171,579 S49Y probably benign Het
Xdh T C 17: 73,910,243 T677A probably damaging Het
Zan A G 5: 137,386,456 L5102P unknown Het
Zfp160 T A 17: 21,020,081 S9T probably benign Het
Zfp273 A T 13: 67,825,554 H267L probably damaging Het
Zfp97 T A 17: 17,144,776 I179K probably benign Het
Zfp975 T C 7: 42,662,292 Y299C probably damaging Het
Other mutations in Col7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Col7a1 APN 9 108977697 nonsense probably null
IGL01366:Col7a1 APN 9 108977119 splice site probably benign
IGL01395:Col7a1 APN 9 108983912 unclassified probably benign
IGL01410:Col7a1 APN 9 108964618 missense unknown
IGL01902:Col7a1 APN 9 108977827 missense unknown
IGL01915:Col7a1 APN 9 108955745 missense unknown
IGL01936:Col7a1 APN 9 108967999 splice site probably benign
IGL01943:Col7a1 APN 9 108984016 critical splice acceptor site probably null
IGL02026:Col7a1 APN 9 108968029 missense probably damaging 1.00
IGL02168:Col7a1 APN 9 108984075 unclassified probably benign
IGL02504:Col7a1 APN 9 108980675 missense unknown
IGL02510:Col7a1 APN 9 108973231 splice site probably benign
IGL02559:Col7a1 APN 9 108973216 missense unknown
IGL02583:Col7a1 APN 9 108962229 missense unknown
IGL02728:Col7a1 APN 9 108984104 missense probably benign 0.39
IGL03003:Col7a1 APN 9 108974956 critical splice donor site probably null
IGL03096:Col7a1 APN 9 108955788 missense unknown
IGL03122:Col7a1 APN 9 108961683 missense unknown
IGL03212:Col7a1 APN 9 108974452 missense unknown
IGL03240:Col7a1 APN 9 108968373 missense probably null 1.00
IGL03355:Col7a1 APN 9 108978160 missense unknown
smallified UTSW 9 108972813 critical splice donor site probably null
underwood UTSW 9 108968875 critical splice acceptor site probably null
PIT4131001:Col7a1 UTSW 9 108965921 splice site probably benign
R0007:Col7a1 UTSW 9 108961403 missense unknown
R0007:Col7a1 UTSW 9 108961403 missense unknown
R0078:Col7a1 UTSW 9 108974913 splice site probably benign
R0091:Col7a1 UTSW 9 108967506 splice site probably benign
R0126:Col7a1 UTSW 9 108969583 splice site probably benign
R0244:Col7a1 UTSW 9 108972184 splice site probably null
R0331:Col7a1 UTSW 9 108967502 splice site probably benign
R0375:Col7a1 UTSW 9 108980237 missense unknown
R0601:Col7a1 UTSW 9 108980584 splice site probably benign
R0609:Col7a1 UTSW 9 108958147 missense unknown
R0709:Col7a1 UTSW 9 108961548 splice site probably benign
R0879:Col7a1 UTSW 9 108976091 splice site probably benign
R1175:Col7a1 UTSW 9 108955334 missense unknown
R1177:Col7a1 UTSW 9 108962441 missense unknown
R1435:Col7a1 UTSW 9 108963273 missense unknown
R1497:Col7a1 UTSW 9 108978825 missense unknown
R1549:Col7a1 UTSW 9 108955966 missense unknown
R1794:Col7a1 UTSW 9 108965928 missense unknown
R1801:Col7a1 UTSW 9 108960997 missense unknown
R1848:Col7a1 UTSW 9 108969565 missense possibly damaging 0.83
R1899:Col7a1 UTSW 9 108978888 missense unknown
R1944:Col7a1 UTSW 9 108960010 missense unknown
R1945:Col7a1 UTSW 9 108960010 missense unknown
R1955:Col7a1 UTSW 9 108955664 missense unknown
R2009:Col7a1 UTSW 9 108968875 critical splice acceptor site probably null
R2034:Col7a1 UTSW 9 108963007 missense unknown
R3148:Col7a1 UTSW 9 108961405 missense unknown
R3713:Col7a1 UTSW 9 108964440 nonsense probably null
R4078:Col7a1 UTSW 9 108960991 missense unknown
R4193:Col7a1 UTSW 9 108956672 missense unknown
R4232:Col7a1 UTSW 9 108972813 critical splice donor site probably null
R4528:Col7a1 UTSW 9 108959533 missense unknown
R4771:Col7a1 UTSW 9 108971925 missense probably damaging 0.99
R4820:Col7a1 UTSW 9 108968607 missense possibly damaging 0.72
R4911:Col7a1 UTSW 9 108975219 missense unknown
R4915:Col7a1 UTSW 9 108966464 missense unknown
R4917:Col7a1 UTSW 9 108966464 missense unknown
R5001:Col7a1 UTSW 9 108965078 critical splice donor site probably null
R5352:Col7a1 UTSW 9 108961411 missense unknown
R5361:Col7a1 UTSW 9 108963224 missense unknown
R5730:Col7a1 UTSW 9 108972242 critical splice donor site probably null
R5838:Col7a1 UTSW 9 108978143 missense unknown
R5842:Col7a1 UTSW 9 108965815 missense unknown
R5932:Col7a1 UTSW 9 108980211 missense unknown
R6091:Col7a1 UTSW 9 108955334 missense unknown
R6144:Col7a1 UTSW 9 108974080 missense unknown
R6158:Col7a1 UTSW 9 108964603 missense unknown
R6170:Col7a1 UTSW 9 108966443 missense unknown
R6247:Col7a1 UTSW 9 108981062 unclassified probably benign
R6338:Col7a1 UTSW 9 108956633 missense unknown
R6339:Col7a1 UTSW 9 108956633 missense unknown
R6382:Col7a1 UTSW 9 108975393 missense unknown
R6518:Col7a1 UTSW 9 108955527 missense unknown
R6533:Col7a1 UTSW 9 108961358 missense unknown
R6569:Col7a1 UTSW 9 108978110 splice site probably null
R6596:Col7a1 UTSW 9 108954341 unclassified probably benign
R6697:Col7a1 UTSW 9 108970533 missense probably damaging 1.00
R6753:Col7a1 UTSW 9 108958128 missense unknown
R6849:Col7a1 UTSW 9 108975053 missense unknown
R6915:Col7a1 UTSW 9 108967618 missense probably benign 0.02
R6974:Col7a1 UTSW 9 108969426 missense possibly damaging 0.82
R6991:Col7a1 UTSW 9 108983919 critical splice donor site probably null
R7028:Col7a1 UTSW 9 108963263 nonsense probably null
X0023:Col7a1 UTSW 9 108984185 unclassified probably benign
Z1088:Col7a1 UTSW 9 108978500 splice site silent
Predicted Primers PCR Primer
(F):5'- GCTGTATACTCTGCTGGAGG -3'
(R):5'- GTTCTGGGGTCAACAGTTCC -3'

Sequencing Primer
(F):5'- TCTGCTGGAGGGCCGTG -3'
(R):5'- ACAGTTCCCGGGATGCAGATG -3'
Posted On2016-03-17