Incidental Mutation 'R4896:Zfp273'
ID377670
Institutional Source Beutler Lab
Gene Symbol Zfp273
Ensembl Gene ENSMUSG00000030446
Gene Namezinc finger protein 273
Synonyms6820416H06Rik
MMRRC Submission 042500-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R4896 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location67813740-67827002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67825554 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 267 (H267L)
Ref Sequence ENSEMBL: ENSMUSP00000137903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012725] [ENSMUST00000181391]
Predicted Effect probably damaging
Transcript: ENSMUST00000012725
AA Change: H234L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000012725
Gene: ENSMUSG00000030446
AA Change: H234L

DomainStartEndE-ValueType
KRAB 1 32 1.97e-1 SMART
ZnF_C2H2 48 70 1.95e-3 SMART
ZnF_C2H2 76 98 4.94e-5 SMART
ZnF_C2H2 104 126 6.32e-3 SMART
ZnF_C2H2 132 154 3.39e-3 SMART
ZnF_C2H2 160 182 2.99e-4 SMART
ZnF_C2H2 188 210 4.24e-4 SMART
ZnF_C2H2 216 238 1.45e-2 SMART
ZnF_C2H2 244 266 1.1e-2 SMART
ZnF_C2H2 272 294 2.91e-2 SMART
ZnF_C2H2 300 322 6.78e-3 SMART
ZnF_C2H2 328 350 2.71e-2 SMART
ZnF_C2H2 356 378 4.17e-3 SMART
ZnF_C2H2 384 406 1.38e-3 SMART
ZnF_C2H2 412 434 1.98e-4 SMART
ZnF_C2H2 440 462 1.2e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000181391
AA Change: H267L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137903
Gene: ENSMUSG00000030446
AA Change: H267L

DomainStartEndE-ValueType
KRAB 5 65 9.25e-28 SMART
ZnF_C2H2 81 103 1.95e-3 SMART
ZnF_C2H2 109 131 4.94e-5 SMART
ZnF_C2H2 137 159 6.32e-3 SMART
ZnF_C2H2 165 187 3.39e-3 SMART
ZnF_C2H2 193 215 2.99e-4 SMART
ZnF_C2H2 221 243 4.24e-4 SMART
ZnF_C2H2 249 271 1.45e-2 SMART
ZnF_C2H2 277 299 1.1e-2 SMART
ZnF_C2H2 305 327 2.91e-2 SMART
ZnF_C2H2 333 355 6.78e-3 SMART
ZnF_C2H2 361 383 2.71e-2 SMART
ZnF_C2H2 389 411 4.17e-3 SMART
ZnF_C2H2 417 439 1.38e-3 SMART
ZnF_C2H2 445 467 1.98e-4 SMART
ZnF_C2H2 473 495 1.2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181912
Meta Mutation Damage Score 0.486 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 99% (101/102)
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,937 S1898P probably benign Het
4932438A13Rik T G 3: 36,965,937 N2108K probably damaging Het
Abcb4 T C 5: 8,907,267 V132A possibly damaging Het
Acpp A T 9: 104,306,975 V292E probably damaging Het
Adamts10 T C 17: 33,528,896 V102A possibly damaging Het
Add2 A G 6: 86,096,746 T206A probably benign Het
Alg12 A T 15: 88,816,188 L15Q probably damaging Het
Ankrd27 T A 7: 35,608,375 D346E probably damaging Het
Armc2 A T 10: 41,923,794 N689K probably damaging Het
Best3 T A 10: 117,024,555 D573E probably benign Het
Ccdc80 A T 16: 45,095,898 Q339L probably benign Het
Cdh9 T C 15: 16,778,156 V19A probably benign Het
Cnksr1 A T 4: 134,229,675 probably null Het
Col7a1 T A 9: 108,957,277 V525E unknown Het
Crebrf T C 17: 26,742,420 S172P possibly damaging Het
Csmd1 T C 8: 16,009,439 I2099V probably benign Het
Dcaf4 T A 12: 83,539,459 M400K possibly damaging Het
Dnah11 A T 12: 117,995,200 F2983I probably damaging Het
Dock6 A G 9: 21,824,437 V1005A possibly damaging Het
Dyrk2 C A 10: 118,868,248 G34C probably damaging Het
Eif4a1 A T 11: 69,668,597 probably benign Het
Eno4 G T 19: 58,964,543 D330Y probably damaging Het
Faf1 G A 4: 109,842,299 C347Y probably benign Het
Fam169a A G 13: 97,097,592 Y124C probably damaging Het
Fam227a G T 15: 79,637,054 F269L probably benign Het
Fam60a A G 6: 148,933,000 probably null Het
Fancm C A 12: 65,075,831 D42E probably damaging Het
Fat1 T A 8: 44,951,280 I356N possibly damaging Het
Fer1l6 A T 15: 58,638,020 T1444S probably damaging Het
Galr1 A G 18: 82,393,940 L267P probably damaging Het
Gbx1 T C 5: 24,504,839 H336R probably damaging Het
Gimap8 A T 6: 48,659,347 Q682L possibly damaging Het
Gm2396 T G 9: 88,931,228 noncoding transcript Het
Gm5798 T C 14: 41,348,657 L8S probably damaging Het
Hmgcll1 C T 9: 76,056,178 S39F possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Il3ra A T 14: 14,355,381 E289D probably benign Het
Isoc1 T A 18: 58,673,278 L220Q probably damaging Het
Itga2 T A 13: 114,853,766 K918* probably null Het
Kat6a C T 8: 22,938,313 T1228I probably benign Het
Klhl30 T A 1: 91,359,324 probably null Het
Krtap6-2 A T 16: 89,419,918 C54S unknown Het
Lmf2 G A 15: 89,351,800 P634S probably benign Het
Map3k4 A G 17: 12,272,019 V175A possibly damaging Het
Mcm3 A C 1: 20,820,256 probably benign Het
Mon1b T C 8: 113,639,227 S396P probably damaging Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Ncor2 A G 5: 125,049,340 probably null Het
Nlrc5 T G 8: 94,521,216 probably benign Het
Nlrp14 GT GTT 7: 107,197,179 probably null Het
Nwd2 T G 5: 63,804,808 S578R probably damaging Het
Odf3 G A 7: 140,848,485 probably benign Het
Olfr1289 G A 2: 111,483,660 V105I possibly damaging Het
Olfr360 A G 2: 37,068,410 Y35C probably damaging Het
Otoa C A 7: 121,102,679 P194T probably damaging Het
Pde1b A C 15: 103,521,374 D98A probably damaging Het
Pi4ka A T 16: 17,377,169 C122S probably damaging Het
Pole2 C T 12: 69,223,150 V67M probably damaging Het
Prickle2 A T 6: 92,416,755 D312E probably benign Het
Prkd1 T C 12: 50,389,962 D453G probably damaging Het
Prrc1 T A 18: 57,374,554 V260E probably damaging Het
Reg3g A T 6: 78,467,810 Y62N probably benign Het
Reln C T 5: 21,955,238 G2111E probably damaging Het
Rsph6a A T 7: 19,057,740 E278V possibly damaging Het
Scpep1 T A 11: 88,941,296 I203F probably damaging Het
Sec24d T C 3: 123,354,947 C747R probably damaging Het
Sec31a A T 5: 100,368,333 N967K probably damaging Het
Sell T C 1: 164,063,062 W5R probably benign Het
Siglec1 C T 2: 131,069,869 V1697M probably benign Het
Slc22a26 T A 19: 7,791,054 I213L probably benign Het
Slc2a13 G A 15: 91,412,212 P300S probably benign Het
Slco1a4 A G 6: 141,815,505 Y461H possibly damaging Het
Slco3a1 G C 7: 74,320,556 C434W probably null Het
Sp3 A T 2: 72,938,289 V666D probably benign Het
Spidr A T 16: 16,118,942 W100R possibly damaging Het
Stk33 T A 7: 109,327,595 M286L probably damaging Het
Sult1c2 T A 17: 53,832,135 I183F probably benign Het
Svep1 G T 4: 58,087,751 T1776K probably benign Het
Tesk2 A G 4: 116,802,993 H436R probably benign Het
Tex2 T C 11: 106,568,404 T67A probably damaging Het
Timm10 T C 2: 84,829,848 S44P possibly damaging Het
Tmed11 C A 5: 108,795,182 probably null Het
Trim12c G A 7: 104,340,948 R441C probably damaging Het
Trmt2a A G 16: 18,252,929 K509E probably damaging Het
Upk3a A G 15: 85,019,423 T108A probably benign Het
Usp29 A G 7: 6,962,159 M334V probably benign Het
Vash1 A G 12: 86,680,142 D52G probably benign Het
Vmn2r14 T G 5: 109,220,380 T249P probably benign Het
Vmn2r43 A T 7: 8,244,849 F772I probably damaging Het
Vmn2r75 G T 7: 86,171,579 S49Y probably benign Het
Xdh T C 17: 73,910,243 T677A probably damaging Het
Zan A G 5: 137,386,456 L5102P unknown Het
Zfp160 T A 17: 21,020,081 S9T probably benign Het
Zfp97 T A 17: 17,144,776 I179K probably benign Het
Zfp975 T C 7: 42,662,292 Y299C probably damaging Het
Other mutations in Zfp273
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03115:Zfp273 APN 13 67825650 missense probably damaging 1.00
R1969:Zfp273 UTSW 13 67825163 missense probably damaging 1.00
R2679:Zfp273 UTSW 13 67825776 missense probably benign 0.39
R3736:Zfp273 UTSW 13 67825507 nonsense probably null
R4832:Zfp273 UTSW 13 67825365 missense probably benign 0.01
R5004:Zfp273 UTSW 13 67825554 missense probably damaging 1.00
R5223:Zfp273 UTSW 13 67826179 missense probably damaging 1.00
R5748:Zfp273 UTSW 13 67825331 missense probably damaging 1.00
R5948:Zfp273 UTSW 13 67825799 missense probably benign 0.43
R6102:Zfp273 UTSW 13 67822347 missense probably damaging 1.00
R6668:Zfp273 UTSW 13 67825124 missense probably damaging 0.99
R7192:Zfp273 UTSW 13 67825064 missense possibly damaging 0.82
R7478:Zfp273 UTSW 13 67825132 missense probably benign 0.30
X0028:Zfp273 UTSW 13 67823142 missense probably benign 0.20
Z1088:Zfp273 UTSW 13 67825394 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AAACCCTACAAATGTGAAGTGTGTG -3'
(R):5'- TTTGTAGGGTTTCATGCCAGTAT -3'

Sequencing Primer
(F):5'- TGTTCACCGAAGAGTACATACTGG -3'
(R):5'- CATGCCAGTATGGATTCGACG -3'
Posted On2016-03-17