Incidental Mutation 'R4896:Alg12'
ID377680
Institutional Source Beutler Lab
Gene Symbol Alg12
Ensembl Gene ENSMUSG00000035845
Gene Nameasparagine-linked glycosylation 12 (alpha-1,6-mannosyltransferase)
SynonymsECM39, mannosyltransferase
MMRRC Submission 042500-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.562) question?
Stock #R4896 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location88805244-88819318 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88816188 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 15 (L15Q)
Ref Sequence ENSEMBL: ENSMUSP00000123935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024042] [ENSMUST00000043087] [ENSMUST00000159328] [ENSMUST00000162183]
Predicted Effect probably benign
Transcript: ENSMUST00000024042
SMART Domains Protein: ENSMUSP00000024042
Gene: ENSMUSG00000023272

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF3456 28 86 1.3e-7 PFAM
low complexity region 90 100 N/A INTRINSIC
EGF 137 176 3.76e-1 SMART
FU 191 238 1.2e-7 SMART
EGF_like 228 273 1.76e-3 SMART
FU 251 298 5.08e-6 SMART
EGF_CA 288 329 3.17e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000043087
AA Change: L15Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043480
Gene: ENSMUSG00000035845
AA Change: L15Q

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 15 267 4e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159328
AA Change: L15Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125534
Gene: ENSMUSG00000035845
AA Change: L15Q

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 15 169 6e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160222
Predicted Effect probably damaging
Transcript: ENSMUST00000162183
AA Change: L15Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123935
Gene: ENSMUSG00000035845
AA Change: L15Q

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 15 406 3.3e-44 PFAM
Meta Mutation Damage Score 0.26 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 99% (101/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 22 family. The encoded protein catalyzes the addition of the eighth mannose residue in an alpha-1,6 linkage onto the dolichol-PP-oligosaccharide precursor (dolichol-PP-Man(7)GlcNAc(2)) required for protein glycosylation. Mutations in this gene have been associated with congenital disorder of glycosylation type Ig (CDG-Ig)characterized by abnormal N-glycosylation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,937 S1898P probably benign Het
4932438A13Rik T G 3: 36,965,937 N2108K probably damaging Het
Abcb4 T C 5: 8,907,267 V132A possibly damaging Het
Acpp A T 9: 104,306,975 V292E probably damaging Het
Adamts10 T C 17: 33,528,896 V102A possibly damaging Het
Add2 A G 6: 86,096,746 T206A probably benign Het
Ankrd27 T A 7: 35,608,375 D346E probably damaging Het
Armc2 A T 10: 41,923,794 N689K probably damaging Het
Best3 T A 10: 117,024,555 D573E probably benign Het
Ccdc80 A T 16: 45,095,898 Q339L probably benign Het
Cdh9 T C 15: 16,778,156 V19A probably benign Het
Cnksr1 A T 4: 134,229,675 probably null Het
Col7a1 T A 9: 108,957,277 V525E unknown Het
Crebrf T C 17: 26,742,420 S172P possibly damaging Het
Csmd1 T C 8: 16,009,439 I2099V probably benign Het
Dcaf4 T A 12: 83,539,459 M400K possibly damaging Het
Dnah11 A T 12: 117,995,200 F2983I probably damaging Het
Dock6 A G 9: 21,824,437 V1005A possibly damaging Het
Dyrk2 C A 10: 118,868,248 G34C probably damaging Het
Eif4a1 A T 11: 69,668,597 probably benign Het
Eno4 G T 19: 58,964,543 D330Y probably damaging Het
Faf1 G A 4: 109,842,299 C347Y probably benign Het
Fam169a A G 13: 97,097,592 Y124C probably damaging Het
Fam227a G T 15: 79,637,054 F269L probably benign Het
Fam60a A G 6: 148,933,000 probably null Het
Fancm C A 12: 65,075,831 D42E probably damaging Het
Fat1 T A 8: 44,951,280 I356N possibly damaging Het
Fer1l6 A T 15: 58,638,020 T1444S probably damaging Het
Galr1 A G 18: 82,393,940 L267P probably damaging Het
Gbx1 T C 5: 24,504,839 H336R probably damaging Het
Gimap8 A T 6: 48,659,347 Q682L possibly damaging Het
Gm2396 T G 9: 88,931,228 noncoding transcript Het
Gm5798 T C 14: 41,348,657 L8S probably damaging Het
Hmgcll1 C T 9: 76,056,178 S39F possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Il3ra A T 14: 14,355,381 E289D probably benign Het
Isoc1 T A 18: 58,673,278 L220Q probably damaging Het
Itga2 T A 13: 114,853,766 K918* probably null Het
Kat6a C T 8: 22,938,313 T1228I probably benign Het
Klhl30 T A 1: 91,359,324 probably null Het
Krtap6-2 A T 16: 89,419,918 C54S unknown Het
Lmf2 G A 15: 89,351,800 P634S probably benign Het
Map3k4 A G 17: 12,272,019 V175A possibly damaging Het
Mcm3 A C 1: 20,820,256 probably benign Het
Mon1b T C 8: 113,639,227 S396P probably damaging Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Ncor2 A G 5: 125,049,340 probably null Het
Nlrc5 T G 8: 94,521,216 probably benign Het
Nlrp14 GT GTT 7: 107,197,179 probably null Het
Nwd2 T G 5: 63,804,808 S578R probably damaging Het
Odf3 G A 7: 140,848,485 probably benign Het
Olfr1289 G A 2: 111,483,660 V105I possibly damaging Het
Olfr360 A G 2: 37,068,410 Y35C probably damaging Het
Otoa C A 7: 121,102,679 P194T probably damaging Het
Pde1b A C 15: 103,521,374 D98A probably damaging Het
Pi4ka A T 16: 17,377,169 C122S probably damaging Het
Pole2 C T 12: 69,223,150 V67M probably damaging Het
Prickle2 A T 6: 92,416,755 D312E probably benign Het
Prkd1 T C 12: 50,389,962 D453G probably damaging Het
Prrc1 T A 18: 57,374,554 V260E probably damaging Het
Reg3g A T 6: 78,467,810 Y62N probably benign Het
Reln C T 5: 21,955,238 G2111E probably damaging Het
Rsph6a A T 7: 19,057,740 E278V possibly damaging Het
Scpep1 T A 11: 88,941,296 I203F probably damaging Het
Sec24d T C 3: 123,354,947 C747R probably damaging Het
Sec31a A T 5: 100,368,333 N967K probably damaging Het
Sell T C 1: 164,063,062 W5R probably benign Het
Siglec1 C T 2: 131,069,869 V1697M probably benign Het
Slc22a26 T A 19: 7,791,054 I213L probably benign Het
Slc2a13 G A 15: 91,412,212 P300S probably benign Het
Slco1a4 A G 6: 141,815,505 Y461H possibly damaging Het
Slco3a1 G C 7: 74,320,556 C434W probably null Het
Sp3 A T 2: 72,938,289 V666D probably benign Het
Spidr A T 16: 16,118,942 W100R possibly damaging Het
Stk33 T A 7: 109,327,595 M286L probably damaging Het
Sult1c2 T A 17: 53,832,135 I183F probably benign Het
Svep1 G T 4: 58,087,751 T1776K probably benign Het
Tesk2 A G 4: 116,802,993 H436R probably benign Het
Tex2 T C 11: 106,568,404 T67A probably damaging Het
Timm10 T C 2: 84,829,848 S44P possibly damaging Het
Tmed11 C A 5: 108,795,182 probably null Het
Trim12c G A 7: 104,340,948 R441C probably damaging Het
Trmt2a A G 16: 18,252,929 K509E probably damaging Het
Upk3a A G 15: 85,019,423 T108A probably benign Het
Usp29 A G 7: 6,962,159 M334V probably benign Het
Vash1 A G 12: 86,680,142 D52G probably benign Het
Vmn2r14 T G 5: 109,220,380 T249P probably benign Het
Vmn2r43 A T 7: 8,244,849 F772I probably damaging Het
Vmn2r75 G T 7: 86,171,579 S49Y probably benign Het
Xdh T C 17: 73,910,243 T677A probably damaging Het
Zan A G 5: 137,386,456 L5102P unknown Het
Zfp160 T A 17: 21,020,081 S9T probably benign Het
Zfp273 A T 13: 67,825,554 H267L probably damaging Het
Zfp97 T A 17: 17,144,776 I179K probably benign Het
Zfp975 T C 7: 42,662,292 Y299C probably damaging Het
Other mutations in Alg12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02557:Alg12 APN 15 88816207 nonsense probably null
R0077:Alg12 UTSW 15 88815978 missense probably damaging 1.00
R0365:Alg12 UTSW 15 88816149 missense possibly damaging 0.80
R0485:Alg12 UTSW 15 88811427 missense probably benign 0.00
R0726:Alg12 UTSW 15 88806647 missense probably damaging 1.00
R2064:Alg12 UTSW 15 88812115 missense probably damaging 1.00
R3404:Alg12 UTSW 15 88814579 missense probably damaging 0.98
R4567:Alg12 UTSW 15 88806353 intron probably benign
R4718:Alg12 UTSW 15 88806053 missense probably damaging 1.00
R4903:Alg12 UTSW 15 88814540 missense probably damaging 0.98
R5059:Alg12 UTSW 15 88811456 missense probably damaging 1.00
R7274:Alg12 UTSW 15 88806707 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACAACTCCAGGAAACTCGT -3'
(R):5'- AGGGGTCTTGTGCTTCCTC -3'

Sequencing Primer
(F):5'- CAGGAAACTCGTGGTGGTC -3'
(R):5'- CTCCTCCACATCTTACCTGTGTGAC -3'
Posted On2016-03-17