Incidental Mutation 'R4896:Adamts10'
ID377693
Institutional Source Beutler Lab
Gene Symbol Adamts10
Ensembl Gene ENSMUSG00000024299
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 10
SynonymsZnMP
MMRRC Submission 042500-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.368) question?
Stock #R4896 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33524204-33553782 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33528896 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 102 (V102A)
Ref Sequence ENSEMBL: ENSMUSP00000133434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087623] [ENSMUST00000172922] [ENSMUST00000173013] [ENSMUST00000173030] [ENSMUST00000173241] [ENSMUST00000173931]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087623
AA Change: V102A

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000084905
Gene: ENSMUSG00000024299
AA Change: V102A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 40 180 1.3e-33 PFAM
Pfam:Reprolysin_5 237 432 5e-15 PFAM
Pfam:Reprolysin_4 237 448 5e-11 PFAM
Pfam:Reprolysin 239 457 1.6e-25 PFAM
Pfam:Reprolysin_2 257 447 1.2e-13 PFAM
Pfam:Reprolysin_3 261 403 5.7e-13 PFAM
TSP1 550 602 7.21e-11 SMART
Pfam:ADAM_spacer1 706 818 1.3e-27 PFAM
TSP1 828 885 4.73e-6 SMART
TSP1 887 940 4.35e-2 SMART
TSP1 948 1003 2.66e-2 SMART
TSP1 1006 1058 9.98e-5 SMART
Pfam:PLAC 1070 1102 8.4e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172922
AA Change: V102A

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133891
Gene: ENSMUSG00000024299
AA Change: V102A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 180 1.1e-30 PFAM
SCOP:d1bkca_ 238 271 4e-7 SMART
low complexity region 285 296 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173013
AA Change: V102A

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134181
Gene: ENSMUSG00000024299
AA Change: V102A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 180 9.6e-31 PFAM
SCOP:d1bkca_ 238 271 3e-7 SMART
low complexity region 285 296 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173030
AA Change: V102A

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134549
Gene: ENSMUSG00000024299
AA Change: V102A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 180 9.6e-31 PFAM
SCOP:d1bkca_ 238 271 3e-7 SMART
low complexity region 285 296 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173241
AA Change: V102A

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134298
Gene: ENSMUSG00000024299
AA Change: V102A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 180 9.6e-31 PFAM
SCOP:d1bkca_ 238 271 3e-7 SMART
low complexity region 285 296 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173813
Predicted Effect possibly damaging
Transcript: ENSMUST00000173931
AA Change: V102A

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133434
Gene: ENSMUSG00000024299
AA Change: V102A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 180 9.6e-31 PFAM
SCOP:d1bkca_ 238 271 3e-7 SMART
low complexity region 285 296 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174170
Predicted Effect probably benign
Transcript: ENSMUST00000174348
SMART Domains Protein: ENSMUSP00000133856
Gene: ENSMUSG00000024299

DomainStartEndE-ValueType
Pfam:Reprolysin_5 23 220 2.6e-16 PFAM
Pfam:Reprolysin_4 23 235 2.6e-12 PFAM
Pfam:Reprolysin 25 243 1e-26 PFAM
Pfam:Reprolysin_2 43 233 7.1e-15 PFAM
Pfam:Reprolysin_3 47 189 4.7e-14 PFAM
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 99% (101/102)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate a functional, zinc-dependent metallopeptidase enzyme. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,937 S1898P probably benign Het
4932438A13Rik T G 3: 36,965,937 N2108K probably damaging Het
Abcb4 T C 5: 8,907,267 V132A possibly damaging Het
Acpp A T 9: 104,306,975 V292E probably damaging Het
Add2 A G 6: 86,096,746 T206A probably benign Het
Alg12 A T 15: 88,816,188 L15Q probably damaging Het
Ankrd27 T A 7: 35,608,375 D346E probably damaging Het
Armc2 A T 10: 41,923,794 N689K probably damaging Het
Best3 T A 10: 117,024,555 D573E probably benign Het
Ccdc80 A T 16: 45,095,898 Q339L probably benign Het
Cdh9 T C 15: 16,778,156 V19A probably benign Het
Cnksr1 A T 4: 134,229,675 probably null Het
Col7a1 T A 9: 108,957,277 V525E unknown Het
Crebrf T C 17: 26,742,420 S172P possibly damaging Het
Csmd1 T C 8: 16,009,439 I2099V probably benign Het
Dcaf4 T A 12: 83,539,459 M400K possibly damaging Het
Dnah11 A T 12: 117,995,200 F2983I probably damaging Het
Dock6 A G 9: 21,824,437 V1005A possibly damaging Het
Dyrk2 C A 10: 118,868,248 G34C probably damaging Het
Eif4a1 A T 11: 69,668,597 probably benign Het
Eno4 G T 19: 58,964,543 D330Y probably damaging Het
Faf1 G A 4: 109,842,299 C347Y probably benign Het
Fam169a A G 13: 97,097,592 Y124C probably damaging Het
Fam227a G T 15: 79,637,054 F269L probably benign Het
Fam60a A G 6: 148,933,000 probably null Het
Fancm C A 12: 65,075,831 D42E probably damaging Het
Fat1 T A 8: 44,951,280 I356N possibly damaging Het
Fer1l6 A T 15: 58,638,020 T1444S probably damaging Het
Galr1 A G 18: 82,393,940 L267P probably damaging Het
Gbx1 T C 5: 24,504,839 H336R probably damaging Het
Gimap8 A T 6: 48,659,347 Q682L possibly damaging Het
Gm2396 T G 9: 88,931,228 noncoding transcript Het
Gm5798 T C 14: 41,348,657 L8S probably damaging Het
Hmgcll1 C T 9: 76,056,178 S39F possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Il3ra A T 14: 14,355,381 E289D probably benign Het
Isoc1 T A 18: 58,673,278 L220Q probably damaging Het
Itga2 T A 13: 114,853,766 K918* probably null Het
Kat6a C T 8: 22,938,313 T1228I probably benign Het
Klhl30 T A 1: 91,359,324 probably null Het
Krtap6-2 A T 16: 89,419,918 C54S unknown Het
Lmf2 G A 15: 89,351,800 P634S probably benign Het
Map3k4 A G 17: 12,272,019 V175A possibly damaging Het
Mcm3 A C 1: 20,820,256 probably benign Het
Mon1b T C 8: 113,639,227 S396P probably damaging Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Ncor2 A G 5: 125,049,340 probably null Het
Nlrc5 T G 8: 94,521,216 probably benign Het
Nlrp14 GT GTT 7: 107,197,179 probably null Het
Nwd2 T G 5: 63,804,808 S578R probably damaging Het
Odf3 G A 7: 140,848,485 probably benign Het
Olfr1289 G A 2: 111,483,660 V105I possibly damaging Het
Olfr360 A G 2: 37,068,410 Y35C probably damaging Het
Otoa C A 7: 121,102,679 P194T probably damaging Het
Pde1b A C 15: 103,521,374 D98A probably damaging Het
Pi4ka A T 16: 17,377,169 C122S probably damaging Het
Pole2 C T 12: 69,223,150 V67M probably damaging Het
Prickle2 A T 6: 92,416,755 D312E probably benign Het
Prkd1 T C 12: 50,389,962 D453G probably damaging Het
Prrc1 T A 18: 57,374,554 V260E probably damaging Het
Reg3g A T 6: 78,467,810 Y62N probably benign Het
Reln C T 5: 21,955,238 G2111E probably damaging Het
Rsph6a A T 7: 19,057,740 E278V possibly damaging Het
Scpep1 T A 11: 88,941,296 I203F probably damaging Het
Sec24d T C 3: 123,354,947 C747R probably damaging Het
Sec31a A T 5: 100,368,333 N967K probably damaging Het
Sell T C 1: 164,063,062 W5R probably benign Het
Siglec1 C T 2: 131,069,869 V1697M probably benign Het
Slc22a26 T A 19: 7,791,054 I213L probably benign Het
Slc2a13 G A 15: 91,412,212 P300S probably benign Het
Slco1a4 A G 6: 141,815,505 Y461H possibly damaging Het
Slco3a1 G C 7: 74,320,556 C434W probably null Het
Sp3 A T 2: 72,938,289 V666D probably benign Het
Spidr A T 16: 16,118,942 W100R possibly damaging Het
Stk33 T A 7: 109,327,595 M286L probably damaging Het
Sult1c2 T A 17: 53,832,135 I183F probably benign Het
Svep1 G T 4: 58,087,751 T1776K probably benign Het
Tesk2 A G 4: 116,802,993 H436R probably benign Het
Tex2 T C 11: 106,568,404 T67A probably damaging Het
Timm10 T C 2: 84,829,848 S44P possibly damaging Het
Tmed11 C A 5: 108,795,182 probably null Het
Trim12c G A 7: 104,340,948 R441C probably damaging Het
Trmt2a A G 16: 18,252,929 K509E probably damaging Het
Upk3a A G 15: 85,019,423 T108A probably benign Het
Usp29 A G 7: 6,962,159 M334V probably benign Het
Vash1 A G 12: 86,680,142 D52G probably benign Het
Vmn2r14 T G 5: 109,220,380 T249P probably benign Het
Vmn2r43 A T 7: 8,244,849 F772I probably damaging Het
Vmn2r75 G T 7: 86,171,579 S49Y probably benign Het
Xdh T C 17: 73,910,243 T677A probably damaging Het
Zan A G 5: 137,386,456 L5102P unknown Het
Zfp160 T A 17: 21,020,081 S9T probably benign Het
Zfp273 A T 13: 67,825,554 H267L probably damaging Het
Zfp97 T A 17: 17,144,776 I179K probably benign Het
Zfp975 T C 7: 42,662,292 Y299C probably damaging Het
Other mutations in Adamts10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01541:Adamts10 APN 17 33543231 missense probably benign 0.24
IGL01865:Adamts10 APN 17 33553166 missense probably damaging 0.99
IGL02391:Adamts10 APN 17 33528811 missense probably benign 0.00
IGL02711:Adamts10 APN 17 33538272 missense probably damaging 0.99
R0122:Adamts10 UTSW 17 33528480 unclassified probably benign
R0207:Adamts10 UTSW 17 33545390 missense possibly damaging 0.64
R0481:Adamts10 UTSW 17 33549373 nonsense probably null
R0508:Adamts10 UTSW 17 33543718 missense probably damaging 1.00
R0558:Adamts10 UTSW 17 33550609 missense probably benign 0.04
R0746:Adamts10 UTSW 17 33549547 nonsense probably null
R1027:Adamts10 UTSW 17 33543763 missense probably benign 0.44
R1449:Adamts10 UTSW 17 33545639 missense probably damaging 0.96
R1471:Adamts10 UTSW 17 33553138 missense probably damaging 1.00
R1522:Adamts10 UTSW 17 33537319 missense probably benign 0.40
R1631:Adamts10 UTSW 17 33537342 missense probably benign 0.25
R1863:Adamts10 UTSW 17 33551432 critical splice donor site probably null
R1913:Adamts10 UTSW 17 33549555 missense probably benign 0.00
R2091:Adamts10 UTSW 17 33551192 critical splice donor site probably null
R2377:Adamts10 UTSW 17 33528892 missense probably damaging 1.00
R3743:Adamts10 UTSW 17 33528712 missense probably damaging 1.00
R4042:Adamts10 UTSW 17 33549540 missense possibly damaging 0.69
R4646:Adamts10 UTSW 17 33545555 missense probably damaging 1.00
R4654:Adamts10 UTSW 17 33537330 missense possibly damaging 0.89
R4695:Adamts10 UTSW 17 33531739 missense possibly damaging 0.95
R4721:Adamts10 UTSW 17 33545537 splice site probably null
R4798:Adamts10 UTSW 17 33528752 missense probably damaging 1.00
R7454:Adamts10 UTSW 17 33545005 missense possibly damaging 0.89
R7494:Adamts10 UTSW 17 33549378 nonsense probably null
R7541:Adamts10 UTSW 17 33531616 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGATGAGCTCCTGTCCAGTTTG -3'
(R):5'- CTTAACTCCCAGAAGGAAGTGG -3'

Sequencing Primer
(F):5'- GAGAGCTATGAGATTGCCTTCCC -3'
(R):5'- CCAGAAGGAAGTGGGTATATCCCC -3'
Posted On2016-03-17