Incidental Mutation 'R4510:Cacna1e'
ID377726
Institutional Source Beutler Lab
Gene Symbol Cacna1e
Ensembl Gene ENSMUSG00000004110
Gene Namecalcium channel, voltage-dependent, R type, alpha 1E subunit
SynonymsCchra1, alpha1E, Cav2.3
MMRRC Submission 041585-MU
Accession Numbers

Genbank: NM_009782; MGI: 106217

Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R4510 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location154390731-154884501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 154561833 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 257 (T257I)
Ref Sequence ENSEMBL: ENSMUSP00000148507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004214] [ENSMUST00000187541] [ENSMUST00000211821]
Predicted Effect probably benign
Transcript: ENSMUST00000004214
AA Change: T11I

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000004214
Gene: ENSMUSG00000004110
AA Change: T11I

DomainStartEndE-ValueType
Pfam:Ion_trans 1 55 6.7e-10 PFAM
Pfam:Ion_trans 168 407 3.3e-56 PFAM
Pfam:PKD_channel 257 401 3.3e-7 PFAM
low complexity region 409 414 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
low complexity region 496 514 N/A INTRINSIC
low complexity region 604 620 N/A INTRINSIC
low complexity region 626 640 N/A INTRINSIC
coiled coil region 793 823 N/A INTRINSIC
Pfam:Ion_trans 847 1128 2.3e-63 PFAM
Pfam:Ion_trans 1172 1429 2.6e-65 PFAM
Pfam:PKD_channel 1256 1424 2.8e-10 PFAM
Pfam:GPHH 1431 1500 1.3e-37 PFAM
Ca_chan_IQ 1555 1589 5.93e-13 SMART
low complexity region 1701 1717 N/A INTRINSIC
low complexity region 1729 1742 N/A INTRINSIC
low complexity region 1764 1780 N/A INTRINSIC
low complexity region 1789 1804 N/A INTRINSIC
low complexity region 1808 1822 N/A INTRINSIC
low complexity region 1832 1846 N/A INTRINSIC
low complexity region 1867 1878 N/A INTRINSIC
low complexity region 1936 1946 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187541
AA Change: T319I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140937
Gene: ENSMUSG00000004110
AA Change: T319I

DomainStartEndE-ValueType
Pfam:Ion_trans 128 351 8.5e-54 PFAM
PDB:4DEX|B 354 462 6e-36 PDB
Pfam:Ion_trans 511 703 2.2e-46 PFAM
Pfam:PKD_channel 565 710 1.4e-6 PFAM
low complexity region 717 722 N/A INTRINSIC
low complexity region 763 777 N/A INTRINSIC
low complexity region 804 822 N/A INTRINSIC
low complexity region 912 928 N/A INTRINSIC
low complexity region 934 948 N/A INTRINSIC
coiled coil region 1101 1131 N/A INTRINSIC
low complexity region 1162 1175 N/A INTRINSIC
Pfam:Ion_trans 1191 1425 4.3e-55 PFAM
Pfam:Ion_trans 1515 1725 5.3e-60 PFAM
Pfam:PKD_channel 1565 1732 4.7e-10 PFAM
Ca_chan_IQ 1863 1897 5.93e-13 SMART
low complexity region 2009 2025 N/A INTRINSIC
low complexity region 2037 2050 N/A INTRINSIC
low complexity region 2072 2088 N/A INTRINSIC
low complexity region 2097 2112 N/A INTRINSIC
low complexity region 2116 2130 N/A INTRINSIC
low complexity region 2140 2154 N/A INTRINSIC
low complexity region 2175 2186 N/A INTRINSIC
low complexity region 2244 2254 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188965
Predicted Effect probably damaging
Transcript: ENSMUST00000211821
AA Change: T257I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.246 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: This gene encodes an integral membrane protein that belongs to the calcium channel alpha-1 subunits family. Voltage-sensitive calcium channels mediate the entry of calcium ions into excitable cells and are also involved in a variety of calcium-dependent processes. Voltage-dependent calcium channels are multi-subunit complexes, comprised of alpha-1, alpha-2, beta and delta subunits in a 1:1:1:1 ratio. The isoform alpha-1E gives rise to R-type calcium currents and belongs to the high-voltage activated group. Calcium channels containing the alpha-1E subunit may be involved in the modulation of neuronal firing patterns, an important component of information processing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit altered R-type Ca2+ channels, increased timidity and body weight, impaired glucose tolerance, reduced locomotor activity, and lack of the cocaine stimulation of locomotor response. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(3) Targeted, other(3) Gene trapped(1)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,277,328 S1530P possibly damaging Het
9330159F19Rik T A 10: 29,224,823 D397E probably benign Het
Abcc10 A G 17: 46,307,210 F1005L probably damaging Het
Ackr4 T C 9: 104,098,731 E339G probably benign Het
Adam39 G T 8: 40,826,291 C573F probably damaging Het
Anks1b A G 10: 90,510,790 T651A probably benign Het
Aoc1 C A 6: 48,907,806 H594Q probably damaging Het
Arid1a A C 4: 133,695,699 probably benign Het
Atp4a G T 7: 30,724,253 E928* probably null Het
Atp5j T C 16: 84,827,974 D104G probably benign Het
Atp8b5 A G 4: 43,320,629 T206A probably damaging Het
Atrn G A 2: 130,935,577 W182* probably null Het
BC017158 A T 7: 128,276,140 F319Y probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Crebrf A G 17: 26,742,964 Y345C probably benign Het
Cyp26b1 G A 6: 84,574,491 R248W probably damaging Het
Dclk3 C A 9: 111,467,992 H201Q probably benign Het
Ddx17 A T 15: 79,538,592 V315E probably damaging Het
Dhrs11 T C 11: 84,825,516 *51W probably null Het
Fgfr4 C A 13: 55,161,515 P455Q possibly damaging Het
Gabbr1 A G 17: 37,069,211 K697E probably damaging Het
Gcnt1 G A 19: 17,330,277 T28I probably benign Het
Gga2 G A 7: 122,021,078 T4M unknown Het
Gm12185 T A 11: 48,908,478 H396L possibly damaging Het
Gm12794 A T 4: 101,941,560 M243L probably benign Het
Gm21976 A G 13: 98,305,331 R123G probably benign Het
Hecw1 A C 13: 14,357,191 V166G probably damaging Het
Hpx A G 7: 105,592,088 V372A possibly damaging Het
Igkv2-109 A G 6: 68,302,978 Y61C probably damaging Het
Igsf1 A G X: 49,786,173 F789S probably damaging Het
Il4ra A G 7: 125,576,108 D496G possibly damaging Het
Ilf3 A G 9: 21,399,215 T547A possibly damaging Het
Insrr C A 3: 87,808,671 P558T possibly damaging Het
Ints9 A G 14: 65,028,932 D411G possibly damaging Het
Irak3 T A 10: 120,145,908 H393L probably damaging Het
Isx G A 8: 74,873,670 M10I probably benign Het
Itga11 A G 9: 62,761,588 D709G probably damaging Het
Kcng2 G T 18: 80,295,715 R453S probably benign Het
Kif5b A G 18: 6,214,011 V664A probably benign Het
Lalba A G 15: 98,482,541 L44P probably benign Het
Ldlrad1 T G 4: 107,209,518 F17V probably benign Het
Lnx1 C T 5: 74,620,192 D382N probably damaging Het
Lrp1 T C 10: 127,593,848 Y451C probably damaging Het
Lrp2 A T 2: 69,480,062 N2722K possibly damaging Het
Mctp1 G A 13: 76,825,272 V431I probably benign Het
Mmrn2 T C 14: 34,403,059 F866L possibly damaging Het
Mylk2 A G 2: 152,917,410 E367G probably damaging Het
Nfatc1 A G 18: 80,635,579 S865P probably damaging Het
Nol6 G C 4: 41,123,526 T74R probably damaging Het
Notch2 T C 3: 98,146,321 M2100T probably benign Het
Parp1 A G 1: 180,591,276 K667R possibly damaging Het
Phlda3 A G 1: 135,766,662 T72A probably damaging Het
Polg T C 7: 79,455,522 Q758R probably benign Het
Polq G A 16: 37,048,563 R765H probably damaging Het
Prkd1 T C 12: 50,392,979 D355G possibly damaging Het
Prpf8 T C 11: 75,491,826 Y398H probably damaging Het
Ripk1 T C 13: 34,026,748 Y309H probably damaging Het
Rngtt A T 4: 33,339,032 Q279L possibly damaging Het
Samd4 T A 14: 47,077,585 V114D probably benign Het
Sec23ip G A 7: 128,779,176 E956K probably damaging Het
Slc4a1ap A T 5: 31,527,403 T128S probably benign Het
Slc5a11 A T 7: 123,235,635 I6F probably benign Het
Slc6a19 A C 13: 73,683,975 L494R probably damaging Het
Slc6a21 A G 7: 45,287,289 D189G probably damaging Het
Slc7a1 G T 5: 148,340,562 A381D probably damaging Het
Smc4 T A 3: 69,016,647 probably null Het
Stk19 T C 17: 34,832,528 E17G probably damaging Het
Tekt5 A C 16: 10,358,013 V556G probably benign Het
Tenm4 T C 7: 96,894,863 F2029L probably benign Het
Thnsl1 T C 2: 21,212,425 V330A probably damaging Het
Tnfrsf21 A G 17: 43,065,019 D432G probably damaging Het
Tnip1 T A 11: 54,926,790 S244C probably benign Het
Tnrc6c A T 11: 117,742,958 N1294I possibly damaging Het
Trpm3 A G 19: 22,988,017 I1625M probably benign Het
Ttn A T 2: 76,745,429 V25040E probably damaging Het
Vwa5a A G 9: 38,722,557 N19D possibly damaging Het
Washc2 A T 6: 116,220,556 D250V probably damaging Het
Xpo1 A G 11: 23,287,401 T755A possibly damaging Het
Zfp462 C T 4: 55,008,934 T300I possibly damaging Het
Zfp937 A C 2: 150,238,511 T154P probably damaging Het
Zzef1 A G 11: 72,888,170 D1819G probably benign Het
Other mutations in Cacna1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Cacna1e APN 1 154403683 missense probably damaging 0.99
IGL01086:Cacna1e APN 1 154471601 missense probably benign 0.04
IGL01302:Cacna1e APN 1 154443907 missense probably damaging 1.00
IGL01386:Cacna1e APN 1 154472377 missense probably benign 0.18
IGL01573:Cacna1e APN 1 154471367 missense probably benign
IGL01676:Cacna1e APN 1 154398476 missense probably damaging 1.00
IGL01676:Cacna1e APN 1 154412450 missense probably damaging 1.00
IGL01762:Cacna1e APN 1 154471373 missense possibly damaging 0.78
IGL01801:Cacna1e APN 1 154471340 missense probably null 0.00
IGL01895:Cacna1e APN 1 154443900 missense probably damaging 1.00
IGL02391:Cacna1e APN 1 154421113 missense probably damaging 1.00
IGL02399:Cacna1e APN 1 154403747 missense probably damaging 1.00
IGL02659:Cacna1e APN 1 154426528 missense probably damaging 1.00
IGL02686:Cacna1e APN 1 154493409 missense probably damaging 1.00
IGL02838:Cacna1e APN 1 154445648 missense probably damaging 1.00
IGL02958:Cacna1e APN 1 154465741 missense probably damaging 1.00
IGL02981:Cacna1e APN 1 154471425 missense probably benign 0.15
IGL03120:Cacna1e APN 1 154443881 missense probably damaging 1.00
IGL03232:Cacna1e APN 1 154493358 missense probably damaging 1.00
IGL03310:Cacna1e APN 1 154442251 missense probably damaging 1.00
IGL03342:Cacna1e APN 1 154466944 critical splice donor site probably null
bezoar UTSW 1 154436554 splice site probably null
hairball UTSW 1 154479305 missense probably damaging 0.97
N/A - 535:Cacna1e UTSW 1 154465764 missense probably damaging 1.00
R0122:Cacna1e UTSW 1 154443901 missense probably damaging 1.00
R0143:Cacna1e UTSW 1 154448947 splice site probably null
R0314:Cacna1e UTSW 1 154442251 missense probably damaging 1.00
R0366:Cacna1e UTSW 1 154416138 missense probably benign 0.03
R0626:Cacna1e UTSW 1 154488817 missense probably damaging 0.99
R0739:Cacna1e UTSW 1 154442278 missense probably damaging 0.97
R1272:Cacna1e UTSW 1 154444968 missense probably damaging 1.00
R1300:Cacna1e UTSW 1 154398673 missense probably benign
R1340:Cacna1e UTSW 1 154472657 missense probably damaging 1.00
R1440:Cacna1e UTSW 1 154561806 missense possibly damaging 0.63
R1449:Cacna1e UTSW 1 154485662 critical splice donor site probably null
R1538:Cacna1e UTSW 1 154561758 missense probably damaging 0.99
R1542:Cacna1e UTSW 1 154477779 missense probably benign 0.01
R1560:Cacna1e UTSW 1 154421104 nonsense probably null
R1748:Cacna1e UTSW 1 154486569 missense possibly damaging 0.92
R1749:Cacna1e UTSW 1 154444000 missense probably damaging 1.00
R1912:Cacna1e UTSW 1 154436449 missense probably damaging 1.00
R1968:Cacna1e UTSW 1 154700494 missense probably damaging 1.00
R1993:Cacna1e UTSW 1 154477817 missense probably damaging 0.97
R1994:Cacna1e UTSW 1 154477817 missense probably damaging 0.97
R2191:Cacna1e UTSW 1 154443845 missense probably damaging 1.00
R2291:Cacna1e UTSW 1 154403683 missense probably damaging 0.99
R2417:Cacna1e UTSW 1 154472193 missense probably damaging 1.00
R3608:Cacna1e UTSW 1 154416085 missense probably benign 0.08
R3757:Cacna1e UTSW 1 154633696 missense probably damaging 0.97
R3890:Cacna1e UTSW 1 154483553 missense probably damaging 1.00
R4015:Cacna1e UTSW 1 154482585 missense probably damaging 1.00
R4088:Cacna1e UTSW 1 154412183 splice site probably null
R4275:Cacna1e UTSW 1 154493325 missense probably damaging 1.00
R4282:Cacna1e UTSW 1 154426550 missense probably benign 0.04
R4297:Cacna1e UTSW 1 154398731 missense probably benign 0.37
R4356:Cacna1e UTSW 1 154443981 missense probably damaging 1.00
R4511:Cacna1e UTSW 1 154561833 missense probably damaging 1.00
R4577:Cacna1e UTSW 1 154402027 missense possibly damaging 0.92
R4590:Cacna1e UTSW 1 154436519 missense possibly damaging 0.87
R4601:Cacna1e UTSW 1 154471613 missense probably benign
R4622:Cacna1e UTSW 1 154471565 missense possibly damaging 0.81
R4626:Cacna1e UTSW 1 154482548 splice site probably null
R4694:Cacna1e UTSW 1 154437266 critical splice donor site probably null
R4727:Cacna1e UTSW 1 154436468 nonsense probably null
R4839:Cacna1e UTSW 1 154421058 missense probably damaging 1.00
R4851:Cacna1e UTSW 1 154436554 splice site probably null
R4894:Cacna1e UTSW 1 154488805 nonsense probably null
R4934:Cacna1e UTSW 1 154481634 nonsense probably null
R4979:Cacna1e UTSW 1 154413993 missense probably damaging 1.00
R5077:Cacna1e UTSW 1 154561729 critical splice donor site probably null
R5128:Cacna1e UTSW 1 154402021 missense probably damaging 0.98
R5214:Cacna1e UTSW 1 154701364 missense possibly damaging 0.93
R5274:Cacna1e UTSW 1 154700504 missense probably damaging 0.98
R5388:Cacna1e UTSW 1 154477796 missense probably damaging 1.00
R5416:Cacna1e UTSW 1 154465779 missense probably damaging 1.00
R5469:Cacna1e UTSW 1 154443937 missense probably damaging 1.00
R5475:Cacna1e UTSW 1 154725709 missense possibly damaging 0.53
R5607:Cacna1e UTSW 1 154471340 missense probably benign 0.00
R5615:Cacna1e UTSW 1 154412170 missense probably damaging 1.00
R5616:Cacna1e UTSW 1 154442194 missense probably damaging 1.00
R5627:Cacna1e UTSW 1 154635858 missense probably damaging 0.98
R5707:Cacna1e UTSW 1 154633717 missense probably damaging 1.00
R5756:Cacna1e UTSW 1 154471637 missense probably benign 0.00
R5893:Cacna1e UTSW 1 154437323 missense probably damaging 1.00
R6117:Cacna1e UTSW 1 154561791 missense possibly damaging 0.68
R6134:Cacna1e UTSW 1 154701291 missense probably damaging 1.00
R6190:Cacna1e UTSW 1 154486570 missense possibly damaging 0.47
R6279:Cacna1e UTSW 1 154425932 missense probably benign 0.38
R6295:Cacna1e UTSW 1 154442173 missense probably damaging 0.98
R6300:Cacna1e UTSW 1 154425932 missense probably benign 0.38
R6320:Cacna1e UTSW 1 154441524 missense possibly damaging 0.76
R6375:Cacna1e UTSW 1 154479305 missense probably damaging 0.97
R6830:Cacna1e UTSW 1 154413974 critical splice donor site probably null
R6842:Cacna1e UTSW 1 154483117 missense probably damaging 1.00
R7023:Cacna1e UTSW 1 154725693 missense probably null 0.85
R7081:Cacna1e UTSW 1 154700383 missense possibly damaging 0.82
R7085:Cacna1e UTSW 1 154473746 intron probably null
R7108:Cacna1e UTSW 1 154468995 frame shift probably null
R7142:Cacna1e UTSW 1 154412484 missense probably damaging 1.00
R7250:Cacna1e UTSW 1 154700489 missense possibly damaging 0.93
X0062:Cacna1e UTSW 1 154412492 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCCCAGTGTCTTTGACG -3'
(R):5'- CTTCACTAGGCACAGGGTAAAATG -3'

Sequencing Primer
(F):5'- CCCAGTGTCTTTGACGTGACAG -3'
(R):5'- CAGGGTAAAATGTGAGTTGTCTTAC -3'
Posted On2016-03-25