Incidental Mutation 'R4593:Dner'
ID377735
Institutional Source Beutler Lab
Gene Symbol Dner
Ensembl Gene ENSMUSG00000036766
Gene Namedelta/notch-like EGF repeat containing
SynonymsA930026D19Rik, BET
MMRRC Submission 041809-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4593 (G1)
Quality Score69
Status Validated
Chromosome1
Chromosomal Location84369839-84696221 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to C at 84695728 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000042927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049126]
Predicted Effect probably null
Transcript: ENSMUST00000049126
AA Change: M1V
SMART Domains Protein: ENSMUSP00000042927
Gene: ENSMUSG00000036766
AA Change: M1V

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
EGF 47 92 9.85e-5 SMART
EGF 97 133 2.33e-6 SMART
EGF 306 348 1.8e1 SMART
EGF 352 390 5e-6 SMART
EGF_CA 392 428 8.97e-8 SMART
EGF 433 466 3.54e-6 SMART
EGF 471 503 4.66e-6 SMART
EGF_CA 505 541 1.61e-9 SMART
EGF 546 579 9.7e-4 SMART
EGF_CA 581 617 4.52e-13 SMART
transmembrane domain 639 661 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191306
Meta Mutation Damage Score 0.418 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (45/47)
MGI Phenotype PHENOTYPE: Homozygous null mice display delayed cerebellar development, abnormal Bergmann glial cells, abnormal Purkinje cell innervation, and impaired coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Atm G T 9: 53,453,594 A8E possibly damaging Het
Atxn3 A T 12: 101,923,177 M333K probably benign Het
Cd86 A G 16: 36,606,556 *310R probably null Het
Cyp2s1 ACAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAG 7: 25,816,442 probably benign Het
Dgat1 C A 15: 76,504,689 R111S probably damaging Het
Dnhd1 G A 7: 105,715,446 D4240N probably benign Het
Emp3 A G 7: 45,919,353 L27P probably damaging Het
Glra3 G T 8: 55,940,881 G9V probably damaging Het
Gpr149 A T 3: 62,602,730 probably benign Het
Ighv1-9 T C 12: 114,583,604 T105A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Ldhd T C 8: 111,629,364 D129G probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrrc37a A G 11: 103,498,969 Y1877H possibly damaging Het
Med13l T C 5: 118,742,560 L1239P probably damaging Het
Mib1 T C 18: 10,768,191 L480S possibly damaging Het
Mkrn3 C T 7: 62,418,804 W413* probably null Het
Myo7b A G 18: 32,013,375 V119A possibly damaging Het
Nexn T A 3: 152,252,916 R113S probably damaging Het
Npas3 A T 12: 54,068,497 Q703L probably benign Het
Npr2 A G 4: 43,647,323 probably benign Het
Nub1 A G 5: 24,709,121 Y624C probably damaging Het
Obscn A C 11: 59,133,249 S532A probably damaging Het
Olfr1016 A G 2: 85,799,664 L202P probably damaging Het
Olfr393 T A 11: 73,847,314 K270N probably benign Het
Panx2 T C 15: 89,067,915 I195T probably damaging Het
Parp11 T C 6: 127,474,299 I104T probably benign Het
Pkd1l1 G T 11: 8,901,253 D726E probably damaging Het
Pom121l2 C T 13: 21,984,453 R965W probably damaging Het
Prrc2c T C 1: 162,697,532 K502E probably damaging Het
Rasa1 T C 13: 85,238,221 probably null Het
Sva T C 6: 42,042,658 S151P possibly damaging Het
Svep1 T C 4: 58,091,944 N1564D possibly damaging Het
Unk T C 11: 116,049,056 I129T probably benign Het
Urb1 T C 16: 90,787,444 D550G probably damaging Het
Vmn1r194 T A 13: 22,244,291 M26K possibly damaging Het
Vmn1r59 A T 7: 5,454,687 F25I possibly damaging Het
Vmn1r88 A G 7: 13,177,842 K42E probably damaging Het
Zbtb24 A G 10: 41,451,957 R280G possibly damaging Het
Other mutations in Dner
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Dner APN 1 84384010 missense probably benign 0.13
IGL02251:Dner APN 1 84384026 missense probably damaging 1.00
IGL02904:Dner APN 1 84534944 missense probably damaging 0.96
IGL03063:Dner APN 1 84585338 missense possibly damaging 0.90
R0013:Dner UTSW 1 84494893 splice site probably benign
R0112:Dner UTSW 1 84583053 missense probably benign 0.06
R0196:Dner UTSW 1 84370832 missense probably damaging 1.00
R0282:Dner UTSW 1 84405965 missense probably damaging 1.00
R0282:Dner UTSW 1 84445380 splice site probably benign
R0942:Dner UTSW 1 84585309 splice site probably benign
R1143:Dner UTSW 1 84445464 missense probably damaging 1.00
R1483:Dner UTSW 1 84585549 utr 5 prime probably benign
R1585:Dner UTSW 1 84585456 missense probably benign 0.05
R1636:Dner UTSW 1 84585330 missense possibly damaging 0.89
R1739:Dner UTSW 1 84370784 missense probably damaging 0.99
R1756:Dner UTSW 1 84445590 missense probably damaging 0.98
R1960:Dner UTSW 1 84445456 missense probably damaging 0.98
R2061:Dner UTSW 1 84405989 missense probably damaging 1.00
R2157:Dner UTSW 1 84383938 missense possibly damaging 0.88
R2265:Dner UTSW 1 84585549 utr 5 prime probably benign
R2382:Dner UTSW 1 84370823 missense probably damaging 1.00
R2507:Dner UTSW 1 84583080 missense probably damaging 1.00
R3053:Dner UTSW 1 84384026 missense probably damaging 1.00
R3917:Dner UTSW 1 84585549 utr 5 prime probably benign
R4530:Dner UTSW 1 84583015 missense probably damaging 1.00
R4552:Dner UTSW 1 84383857 missense probably damaging 1.00
R4579:Dner UTSW 1 84383816 missense probably damaging 0.97
R4711:Dner UTSW 1 84383897 missense possibly damaging 0.75
R5102:Dner UTSW 1 84405970 missense probably damaging 1.00
R5314:Dner UTSW 1 84580739 missense probably damaging 1.00
R5370:Dner UTSW 1 84585549 utr 5 prime probably benign
R6000:Dner UTSW 1 84383929 missense possibly damaging 0.80
R6644:Dner UTSW 1 84395707 missense probably damaging 1.00
R6764:Dner UTSW 1 84494781 missense probably damaging 1.00
R6948:Dner UTSW 1 84406017 missense probably damaging 1.00
R6991:Dner UTSW 1 84476402 nonsense probably null
R7056:Dner UTSW 1 84580736 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- ACAATAGGTGCCAGAGACCC -3'
(R):5'- CTTGCAACTTGCTGAGACGC -3'

Sequencing Primer
(F):5'- GACAGGTGCAGCTGTAGC -3'
(R):5'- AGCAGAAGGGTTCCCATCC -3'
Posted On2016-04-01