Incidental Mutation 'R4593:Urb1'
ID377736
Institutional Source Beutler Lab
Gene Symbol Urb1
Ensembl Gene ENSMUSG00000039929
Gene NameURB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Synonyms4921511H13Rik, 5730405K23Rik
MMRRC Submission 041809-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R4593 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location90751527-90810413 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90787444 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 550 (D550G)
Ref Sequence ENSEMBL: ENSMUSP00000114717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140920]
Predicted Effect probably damaging
Transcript: ENSMUST00000140920
AA Change: D550G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114717
Gene: ENSMUSG00000039929
AA Change: D550G

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:Npa1 78 396 1.5e-86 PFAM
low complexity region 751 761 N/A INTRINSIC
low complexity region 955 966 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
low complexity region 1360 1375 N/A INTRINSIC
Pfam:NopRA1 1670 1859 3.6e-60 PFAM
low complexity region 2029 2040 N/A INTRINSIC
low complexity region 2092 2111 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142955
Meta Mutation Damage Score 0.39 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (45/47)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Atm G T 9: 53,453,594 A8E possibly damaging Het
Atxn3 A T 12: 101,923,177 M333K probably benign Het
Cd86 A G 16: 36,606,556 *310R probably null Het
Cyp2s1 ACAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAG 7: 25,816,442 probably benign Het
Dgat1 C A 15: 76,504,689 R111S probably damaging Het
Dner T C 1: 84,695,728 M1V probably null Het
Dnhd1 G A 7: 105,715,446 D4240N probably benign Het
Emp3 A G 7: 45,919,353 L27P probably damaging Het
Glra3 G T 8: 55,940,881 G9V probably damaging Het
Gpr149 A T 3: 62,602,730 probably benign Het
Ighv1-9 T C 12: 114,583,604 T105A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Ldhd T C 8: 111,629,364 D129G probably damaging Het
Lnpep A G 17: 17,579,027 V122A probably benign Het
Lrrc37a A G 11: 103,498,969 Y1877H possibly damaging Het
Med13l T C 5: 118,742,560 L1239P probably damaging Het
Mib1 T C 18: 10,768,191 L480S possibly damaging Het
Mkrn3 C T 7: 62,418,804 W413* probably null Het
Myo7b A G 18: 32,013,375 V119A possibly damaging Het
Nexn T A 3: 152,252,916 R113S probably damaging Het
Npas3 A T 12: 54,068,497 Q703L probably benign Het
Npr2 A G 4: 43,647,323 probably benign Het
Nub1 A G 5: 24,709,121 Y624C probably damaging Het
Obscn A C 11: 59,133,249 S532A probably damaging Het
Olfr1016 A G 2: 85,799,664 L202P probably damaging Het
Olfr393 T A 11: 73,847,314 K270N probably benign Het
Panx2 T C 15: 89,067,915 I195T probably damaging Het
Parp11 T C 6: 127,474,299 I104T probably benign Het
Pkd1l1 G T 11: 8,901,253 D726E probably damaging Het
Pom121l2 C T 13: 21,984,453 R965W probably damaging Het
Prrc2c T C 1: 162,697,532 K502E probably damaging Het
Rasa1 T C 13: 85,238,221 probably null Het
Sva T C 6: 42,042,658 S151P possibly damaging Het
Svep1 T C 4: 58,091,944 N1564D possibly damaging Het
Unk T C 11: 116,049,056 I129T probably benign Het
Vmn1r194 T A 13: 22,244,291 M26K possibly damaging Het
Vmn1r59 A T 7: 5,454,687 F25I possibly damaging Het
Vmn1r88 A G 7: 13,177,842 K42E probably damaging Het
Zbtb24 A G 10: 41,451,957 R280G possibly damaging Het
Other mutations in Urb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Urb1 APN 16 90753321 critical splice donor site probably null
IGL00915:Urb1 APN 16 90779098 missense possibly damaging 0.76
IGL01108:Urb1 APN 16 90792814 missense probably damaging 1.00
IGL01122:Urb1 APN 16 90804458 missense possibly damaging 0.81
IGL01387:Urb1 APN 16 90757761 missense possibly damaging 0.64
IGL01484:Urb1 APN 16 90777560 missense probably benign 0.11
IGL01606:Urb1 APN 16 90760459 missense probably damaging 1.00
IGL01989:Urb1 APN 16 90769586 splice site probably benign
IGL02516:Urb1 APN 16 90772695 missense possibly damaging 0.49
IGL03018:Urb1 APN 16 90788156 missense probably benign 0.02
IGL03165:Urb1 APN 16 90780304 missense probably damaging 1.00
IGL03216:Urb1 APN 16 90788114 missense probably benign 0.00
H8562:Urb1 UTSW 16 90769469 missense probably benign 0.08
H8786:Urb1 UTSW 16 90769469 missense probably benign 0.08
R0064:Urb1 UTSW 16 90779140 missense probably benign
R0064:Urb1 UTSW 16 90779140 missense probably benign
R0359:Urb1 UTSW 16 90791160 missense probably damaging 1.00
R0386:Urb1 UTSW 16 90796399 missense probably damaging 1.00
R0508:Urb1 UTSW 16 90783262 splice site probably benign
R0517:Urb1 UTSW 16 90777422 nonsense probably null
R0704:Urb1 UTSW 16 90776207 missense probably benign 0.31
R0755:Urb1 UTSW 16 90774094 missense probably damaging 1.00
R0755:Urb1 UTSW 16 90779138 missense probably benign
R0783:Urb1 UTSW 16 90810297 missense possibly damaging 0.55
R0833:Urb1 UTSW 16 90795448 missense possibly damaging 0.89
R0836:Urb1 UTSW 16 90795448 missense possibly damaging 0.89
R0970:Urb1 UTSW 16 90769447 missense possibly damaging 0.83
R1144:Urb1 UTSW 16 90776318 splice site probably null
R1344:Urb1 UTSW 16 90769466 missense probably damaging 1.00
R1418:Urb1 UTSW 16 90769466 missense probably damaging 1.00
R1453:Urb1 UTSW 16 90796492 missense probably damaging 1.00
R1470:Urb1 UTSW 16 90752014 missense probably benign 0.34
R1470:Urb1 UTSW 16 90752014 missense probably benign 0.34
R1520:Urb1 UTSW 16 90774745 missense probably benign 0.00
R1521:Urb1 UTSW 16 90753863 missense probably damaging 1.00
R1598:Urb1 UTSW 16 90777440 missense possibly damaging 0.93
R1617:Urb1 UTSW 16 90760452 missense possibly damaging 0.82
R1625:Urb1 UTSW 16 90774048 critical splice donor site probably null
R1640:Urb1 UTSW 16 90772626 missense probably benign 0.00
R1664:Urb1 UTSW 16 90788082 critical splice donor site probably null
R1672:Urb1 UTSW 16 90787397 missense probably damaging 1.00
R1694:Urb1 UTSW 16 90767040 missense probably benign
R1856:Urb1 UTSW 16 90761695 missense probably benign 0.00
R2001:Urb1 UTSW 16 90762344 missense probably benign 0.30
R2196:Urb1 UTSW 16 90774256 missense probably benign 0.01
R2850:Urb1 UTSW 16 90774256 missense probably benign 0.01
R3009:Urb1 UTSW 16 90774798 missense probably benign 0.09
R3104:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3105:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3106:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3160:Urb1 UTSW 16 90797903 missense probably damaging 1.00
R3162:Urb1 UTSW 16 90797903 missense probably damaging 1.00
R3900:Urb1 UTSW 16 90783376 missense possibly damaging 0.86
R4014:Urb1 UTSW 16 90769465 missense probably damaging 1.00
R4036:Urb1 UTSW 16 90788086 missense probably benign
R4332:Urb1 UTSW 16 90774537 missense probably damaging 1.00
R4448:Urb1 UTSW 16 90769394 missense possibly damaging 0.71
R4581:Urb1 UTSW 16 90788146 missense probably benign 0.04
R4610:Urb1 UTSW 16 90776271 missense probably benign 0.43
R4659:Urb1 UTSW 16 90776129 missense probably damaging 0.96
R4672:Urb1 UTSW 16 90772634 missense probably benign
R4681:Urb1 UTSW 16 90804537 missense probably damaging 0.99
R4771:Urb1 UTSW 16 90753518 missense probably benign 0.00
R4790:Urb1 UTSW 16 90769555 nonsense probably null
R4798:Urb1 UTSW 16 90757827 missense probably benign 0.12
R4809:Urb1 UTSW 16 90759842 missense possibly damaging 0.82
R4850:Urb1 UTSW 16 90795414 nonsense probably null
R4916:Urb1 UTSW 16 90783328 missense probably damaging 1.00
R4969:Urb1 UTSW 16 90805411 missense probably damaging 1.00
R5032:Urb1 UTSW 16 90756171 missense probably benign 0.00
R5111:Urb1 UTSW 16 90752017 missense probably benign 0.00
R5122:Urb1 UTSW 16 90752095 nonsense probably null
R5184:Urb1 UTSW 16 90783274 critical splice donor site probably null
R5199:Urb1 UTSW 16 90792748 missense possibly damaging 0.95
R5436:Urb1 UTSW 16 90792762 missense probably damaging 1.00
R5767:Urb1 UTSW 16 90776163 missense probably benign 0.00
R5812:Urb1 UTSW 16 90804537 missense probably damaging 0.99
R5872:Urb1 UTSW 16 90772764 nonsense probably null
R6052:Urb1 UTSW 16 90762383 missense probably damaging 1.00
R6063:Urb1 UTSW 16 90789097 missense probably benign 0.02
R6065:Urb1 UTSW 16 90803332 missense probably benign 0.03
R6181:Urb1 UTSW 16 90779094 missense probably benign 0.00
R6268:Urb1 UTSW 16 90753919 missense probably benign 0.03
R6429:Urb1 UTSW 16 90762430 splice site probably null
R6572:Urb1 UTSW 16 90787414 missense probably benign 0.37
R6606:Urb1 UTSW 16 90810268 missense probably benign 0.00
R6730:Urb1 UTSW 16 90779083 missense possibly damaging 0.89
R6838:Urb1 UTSW 16 90782106 missense possibly damaging 0.93
R7237:Urb1 UTSW 16 90791166 missense probably damaging 1.00
R7238:Urb1 UTSW 16 90752115 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GATCCTCAGCTCCTAGACTCTG -3'
(R):5'- GAAGGCTTAAGACCAGTCCC -3'

Sequencing Primer
(F):5'- AGCTCCTAGACTCTGCTGCAG -3'
(R):5'- GCCTGAGTATGTATGCAG -3'
Posted On2016-04-01