Incidental Mutation 'R4610:Frem2'
ID377739
Institutional Source Beutler Lab
Gene Symbol Frem2
Ensembl Gene ENSMUSG00000037016
Gene NameFras1 related extracellular matrix protein 2
Synonymsmy, ne, 6030440P17Rik, b2b1562Clo, 8430406N05Rik
MMRRC Submission 041821-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4610 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location53513938-53657355 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53547807 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 2116 (L2116S)
Ref Sequence ENSEMBL: ENSMUSP00000088670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091137]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091137
AA Change: L2116S

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088670
Gene: ENSMUSG00000037016
AA Change: L2116S

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:Cadherin_3 249 388 4.3e-9 PFAM
Pfam:Cadherin_3 376 532 3e-34 PFAM
Pfam:Cadherin_3 516 665 7.5e-24 PFAM
Pfam:Cadherin_3 632 798 1.6e-21 PFAM
Pfam:Cadherin_3 763 910 1.2e-25 PFAM
Pfam:Cadherin_3 879 1027 5.1e-18 PFAM
Pfam:Cadherin_3 1015 1159 2.2e-20 PFAM
CA 1202 1293 4.8e-1 SMART
Pfam:Cadherin_3 1392 1503 9.8e-24 PFAM
Pfam:Cadherin_3 1504 1612 6.2e-28 PFAM
Pfam:Cadherin_3 1613 1743 5.3e-20 PFAM
Calx_beta 1748 1847 1.5e-5 SMART
Calx_beta 1860 1971 9.47e-12 SMART
Calx_beta 1985 2092 1.65e-11 SMART
Calx_beta 2105 2209 1.99e-5 SMART
Calx_beta 2227 2331 6.9e-14 SMART
transmembrane domain 3103 3125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197519
Meta Mutation Damage Score 0.218 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (121/124)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The encoded protein localizes to the basement membrane, forming a ternary complex that plays a role in epidermal-dermal interactions. This protein is important for the integrity of skin and renal epithelia. Mutations in this gene are associated with Fraser syndrome. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for mutations at this locus display a significant amount of embryonic lethality due to hemorrhaging of embryonic blisters. Kidney development is severely affected and syndactyly is common. Phenotypes of homozygous mutants are indistinguishable from those of Fras1 homozygous mutant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
Aars2 T A 17: 45,516,921 D555E probably damaging Het
Adgre1 C A 17: 57,450,073 Q777K possibly damaging Het
Agpat4 G A 17: 12,210,377 probably null Het
Ak7 G A 12: 105,713,575 V123M probably benign Het
Ankle1 AT A 8: 71,407,207 probably benign Het
Ankrd44 T G 1: 54,766,748 probably benign Het
Aprt A T 8: 122,575,415 probably null Het
Aptx T C 4: 40,702,766 probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Bbip1 T C 19: 53,932,175 M1V probably null Het
Cacng7 T A 7: 3,336,691 M36K probably benign Het
Camta1 A G 4: 151,084,827 W156R probably damaging Het
Casd1 G A 6: 4,631,165 probably null Het
Casz1 T A 4: 148,933,267 Y338N probably damaging Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Celf2 G T 2: 6,586,020 N279K possibly damaging Het
Cit A G 5: 115,994,087 T1801A probably benign Het
Cnot2 A G 10: 116,499,418 I275T probably damaging Het
Ddx4 T C 13: 112,612,060 K435E probably damaging Het
Dnajc6 T C 4: 101,611,264 F166L probably damaging Het
Dst T C 1: 34,169,856 L820P probably damaging Het
Dusp11 T A 6: 85,950,055 N193Y probably damaging Het
Eif3m A T 2: 105,013,288 N116K probably benign Het
Epb41l1 A T 2: 156,509,261 E418D possibly damaging Het
Esyt2 T G 12: 116,318,890 N153K probably damaging Het
Exoc6b T G 6: 85,003,159 probably benign Het
Ezr C T 17: 6,739,722 E502K possibly damaging Het
Fbxw11 T A 11: 32,711,859 Y66N possibly damaging Het
Fry T C 5: 150,386,104 L671P probably damaging Het
Galnt7 A G 8: 57,545,769 I262T probably damaging Het
Glp1r T C 17: 30,931,247 F381S probably benign Het
Gm3867 T C 9: 36,257,271 noncoding transcript Het
Gm5662 T C 12: 88,271,774 N72S probably benign Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Golgb1 A G 16: 36,918,625 D2442G probably damaging Het
Gp1bb A T 16: 18,621,143 L67Q probably damaging Het
Gstm7 G A 3: 107,926,919 T206I possibly damaging Het
Hist1h2bf A T 13: 23,574,057 V45E possibly damaging Het
Hs3st5 A T 10: 36,828,806 D35V probably benign Het
Hspa13 T C 16: 75,761,302 H125R probably benign Het
Hspa1a T G 17: 34,971,180 H249P probably damaging Het
Igkv10-95 A T 6: 68,680,578 Q6L probably damaging Het
Il1rap T A 16: 26,714,776 L474H probably benign Het
Ipo11 T A 13: 106,879,737 Y489F probably benign Het
Itga5 A G 15: 103,350,832 Y723H probably damaging Het
Itih2 T C 2: 10,105,160 N594S probably damaging Het
Itk T A 11: 46,336,515 Q427L probably benign Het
Kif26b A G 1: 178,679,355 Y332C probably damaging Het
Kmt2c G A 5: 25,354,384 R1086W probably damaging Het
Ktn1 T A 14: 47,726,179 probably benign Het
Lars2 T A 9: 123,418,693 I305N probably damaging Het
Lgmn G T 12: 102,400,124 probably benign Het
Ltbp4 C T 7: 27,306,700 E1453K probably damaging Het
Lypd8 G A 11: 58,386,849 M152I probably benign Het
Man2a1 T A 17: 64,712,459 S773T probably benign Het
Map2k6 T G 11: 110,499,474 L278R probably damaging Het
Mbtps1 A T 8: 119,535,347 D354E probably damaging Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mms19 A G 19: 41,945,496 V811A possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtcl1 T A 17: 66,377,887 H520L probably benign Het
Mymk A T 2: 27,062,707 F130I probably damaging Het
Myo1f C T 17: 33,582,332 R333C probably damaging Het
Myo9a T A 9: 59,871,882 H1640Q probably benign Het
Nav1 A G 1: 135,592,448 probably benign Het
Ncbp3 G T 11: 73,079,018 G564C probably damaging Het
Ncoa4 A T 14: 32,176,725 I501L probably benign Het
Ngp T A 9: 110,420,815 N60K possibly damaging Het
Npc1l1 G T 11: 6,228,215 D398E probably damaging Het
Nphs2 T A 1: 156,326,131 M264K probably damaging Het
Olfr1193 G A 2: 88,677,896 V14I probably benign Het
Olfr1193 T G 2: 88,678,179 V101G probably benign Het
Olfr145 T A 9: 37,898,326 S307R probably benign Het
Olfr58 T A 9: 19,783,146 Y4* probably null Het
Patz1 A G 11: 3,306,241 Y509C probably damaging Het
Pax8 G A 2: 24,421,583 P447S probably damaging Het
Pde11a A G 2: 76,158,333 V488A probably benign Het
Pex11g C T 8: 3,465,899 V45M probably benign Het
Pik3ip1 T A 11: 3,333,327 S142R probably damaging Het
Pitpnm2 C G 5: 124,125,371 A819P probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Plin4 T A 17: 56,105,418 M538L probably benign Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Rev1 T C 1: 38,053,649 E1202G probably damaging Het
Rngtt T A 4: 33,339,133 probably benign Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Sgsm1 A T 5: 113,255,307 F958Y probably damaging Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Sorl1 C T 9: 42,031,914 V889M possibly damaging Het
Sptlc3 G A 2: 139,636,680 V520I probably benign Het
Stam A T 2: 14,115,858 H53L probably damaging Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Tarbp1 A G 8: 126,474,330 Y246H probably damaging Het
Tbx15 A G 3: 99,352,367 Y518C probably damaging Het
Tdrd5 T A 1: 156,284,374 T479S probably benign Het
Tescl T C 7: 24,333,258 E214G probably damaging Het
Tex10 T C 4: 48,452,946 D671G probably benign Het
Tmem132d A G 5: 127,984,296 V414A probably benign Het
Tmem41b T A 7: 109,974,734 probably benign Het
Tnfrsf18 A G 4: 156,021,880 probably benign Het
Tulp4 T A 17: 6,198,833 D42E probably damaging Het
Ubtd1 A G 19: 42,033,664 N125S probably damaging Het
Ubxn4 T A 1: 128,255,449 F68I probably benign Het
Urb1 A G 16: 90,776,271 S958P probably benign Het
Vash2 T C 1: 190,960,301 S226G probably benign Het
Vmn2r120 C T 17: 57,509,120 G745E probably damaging Het
Vmn2r58 T A 7: 41,837,693 I593F probably benign Het
Zfp398 T C 6: 47,840,427 L67P probably damaging Het
Zfp607b T A 7: 27,703,695 H525Q probably damaging Het
Zfp629 T C 7: 127,612,320 T106A probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Zic5 T A 14: 122,464,800 D173V probably damaging Het
Zranb2 G A 3: 157,541,884 probably benign Het
Other mutations in Frem2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Frem2 APN 3 53585595 missense probably damaging 1.00
IGL00911:Frem2 APN 3 53572462 missense probably damaging 1.00
IGL01322:Frem2 APN 3 53541038 missense probably benign 0.00
IGL01330:Frem2 APN 3 53655241 missense possibly damaging 0.70
IGL01406:Frem2 APN 3 53525896 missense probably damaging 1.00
IGL01556:Frem2 APN 3 53535281 missense probably benign 0.23
IGL01580:Frem2 APN 3 53655175 missense probably damaging 1.00
IGL01606:Frem2 APN 3 53653591 missense possibly damaging 0.69
IGL01611:Frem2 APN 3 53655709 missense probably benign 0.00
IGL01648:Frem2 APN 3 53535732 missense possibly damaging 0.86
IGL01663:Frem2 APN 3 53517013 missense probably damaging 1.00
IGL01665:Frem2 APN 3 53549662 missense probably benign 0.07
IGL01670:Frem2 APN 3 53656937 missense possibly damaging 0.95
IGL01960:Frem2 APN 3 53522304 missense probably benign 0.33
IGL02175:Frem2 APN 3 53655599 missense possibly damaging 0.69
IGL02201:Frem2 APN 3 53519640 missense probably benign 0.35
IGL02202:Frem2 APN 3 53654799 missense probably benign 0.00
IGL02427:Frem2 APN 3 53535763 missense probably damaging 0.97
IGL02457:Frem2 APN 3 53521049 missense probably damaging 0.99
IGL02638:Frem2 APN 3 53551346 missense possibly damaging 0.94
IGL02801:Frem2 APN 3 53652175 missense possibly damaging 0.85
IGL03023:Frem2 APN 3 53655628 missense probably benign 0.40
IGL03169:Frem2 APN 3 53522292 missense probably benign 0.01
IGL03238:Frem2 APN 3 53656261 missense possibly damaging 0.93
IGL03251:Frem2 APN 3 53572308 missense probably benign 0.01
IGL03273:Frem2 APN 3 53537509 nonsense probably null
IGL03343:Frem2 APN 3 53652253 missense probably damaging 1.00
Biosimilar UTSW 3 53654323 missense probably benign 0.01
Fruit_stripe UTSW 3 53537489 missense probably benign 0.21
PIT4366001:Frem2 UTSW 3 53653201 missense probably damaging 0.98
R0019:Frem2 UTSW 3 53523678 missense probably damaging 0.99
R0092:Frem2 UTSW 3 53589796 missense probably benign 0.03
R0108:Frem2 UTSW 3 53647961 missense probably benign 0.03
R0115:Frem2 UTSW 3 53656208 missense probably damaging 0.99
R0118:Frem2 UTSW 3 53535243 nonsense probably null
R0374:Frem2 UTSW 3 53653960 missense probably damaging 1.00
R0437:Frem2 UTSW 3 53653015 missense possibly damaging 0.96
R0531:Frem2 UTSW 3 53519954 missense probably damaging 1.00
R0555:Frem2 UTSW 3 53516860 missense probably damaging 0.97
R0564:Frem2 UTSW 3 53656109 missense probably damaging 0.97
R0586:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R0726:Frem2 UTSW 3 53519626 missense possibly damaging 0.89
R0925:Frem2 UTSW 3 53653973 missense probably benign
R1233:Frem2 UTSW 3 53547778 missense probably damaging 0.98
R1302:Frem2 UTSW 3 53655538 missense probably benign 0.00
R1333:Frem2 UTSW 3 53549731 missense probably benign 0.26
R1446:Frem2 UTSW 3 53654596 missense probably benign 0.31
R1523:Frem2 UTSW 3 53655407 missense possibly damaging 0.73
R1539:Frem2 UTSW 3 53654210 missense probably benign 0.19
R1543:Frem2 UTSW 3 53572455 missense possibly damaging 0.86
R1597:Frem2 UTSW 3 53654519 missense probably benign 0.19
R1600:Frem2 UTSW 3 53547723 missense probably damaging 1.00
R1678:Frem2 UTSW 3 53519938 missense probably damaging 1.00
R1687:Frem2 UTSW 3 53653952 missense probably benign
R1696:Frem2 UTSW 3 53656042 nonsense probably null
R1758:Frem2 UTSW 3 53653357 missense probably damaging 1.00
R1857:Frem2 UTSW 3 53654873 missense probably benign 0.10
R1869:Frem2 UTSW 3 53535196 missense probably benign 0.04
R1921:Frem2 UTSW 3 53653495 missense possibly damaging 0.76
R1973:Frem2 UTSW 3 53652232 missense probably benign 0.01
R2045:Frem2 UTSW 3 53535744 missense probably damaging 1.00
R2113:Frem2 UTSW 3 53652922 missense probably damaging 1.00
R2152:Frem2 UTSW 3 53517029 nonsense probably null
R2164:Frem2 UTSW 3 53537330 missense probably damaging 1.00
R2181:Frem2 UTSW 3 53574587 missense possibly damaging 0.72
R2201:Frem2 UTSW 3 53516573 missense probably benign
R2221:Frem2 UTSW 3 53516857 missense probably benign 0.00
R2255:Frem2 UTSW 3 53652514 missense probably damaging 0.96
R2280:Frem2 UTSW 3 53572423 missense probably damaging 1.00
R3196:Frem2 UTSW 3 53537331 missense probably damaging 1.00
R3716:Frem2 UTSW 3 53572360 missense probably damaging 1.00
R3807:Frem2 UTSW 3 53653449 missense probably benign 0.22
R3820:Frem2 UTSW 3 53516849 missense probably damaging 1.00
R3821:Frem2 UTSW 3 53652415 missense probably damaging 1.00
R3977:Frem2 UTSW 3 53652070 missense probably benign 0.00
R3979:Frem2 UTSW 3 53652070 missense probably benign 0.00
R4014:Frem2 UTSW 3 53652353 missense probably benign 0.01
R4127:Frem2 UTSW 3 53525896 missense probably damaging 1.00
R4195:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4196:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4374:Frem2 UTSW 3 53545502 missense possibly damaging 0.61
R4427:Frem2 UTSW 3 53539162 critical splice donor site probably null
R4428:Frem2 UTSW 3 53654338 missense probably benign 0.40
R4559:Frem2 UTSW 3 53654321 missense probably benign 0.01
R4600:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4602:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4611:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4661:Frem2 UTSW 3 53655443 missense probably damaging 1.00
R4678:Frem2 UTSW 3 53544371 missense probably benign 0.00
R4689:Frem2 UTSW 3 53547635 missense probably benign 0.43
R4740:Frem2 UTSW 3 53535819 missense probably benign 0.04
R4748:Frem2 UTSW 3 53541093 missense probably damaging 1.00
R4790:Frem2 UTSW 3 53516741 missense probably benign
R4809:Frem2 UTSW 3 53653895 missense probably benign 0.01
R4930:Frem2 UTSW 3 53656315 missense possibly damaging 0.93
R4971:Frem2 UTSW 3 53539183 missense probably damaging 1.00
R5057:Frem2 UTSW 3 53535196 missense probably benign 0.37
R5202:Frem2 UTSW 3 53551346 missense probably benign 0.41
R5221:Frem2 UTSW 3 53585611 missense probably damaging 1.00
R5231:Frem2 UTSW 3 53522295 missense probably damaging 1.00
R5268:Frem2 UTSW 3 53653154 missense probably damaging 0.96
R5480:Frem2 UTSW 3 53656507 nonsense probably null
R5637:Frem2 UTSW 3 53652937 missense probably damaging 0.97
R5664:Frem2 UTSW 3 53652490 missense probably benign 0.33
R5698:Frem2 UTSW 3 53652505 missense possibly damaging 0.89
R5744:Frem2 UTSW 3 53655959 missense probably damaging 1.00
R5754:Frem2 UTSW 3 53537258 missense probably damaging 1.00
R5808:Frem2 UTSW 3 53652563 missense probably damaging 0.96
R5840:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R5874:Frem2 UTSW 3 53537489 missense probably benign 0.21
R6050:Frem2 UTSW 3 53653012 missense probably damaging 0.99
R6103:Frem2 UTSW 3 53549788 missense probably benign 0.00
R6149:Frem2 UTSW 3 53551341 missense probably damaging 0.98
R6182:Frem2 UTSW 3 53647969 missense probably damaging 1.00
R6191:Frem2 UTSW 3 53655280 missense probably benign 0.10
R6245:Frem2 UTSW 3 53655824 missense probably benign 0.00
R6252:Frem2 UTSW 3 53572448 missense probably damaging 1.00
R6393:Frem2 UTSW 3 53585640 missense possibly damaging 0.91
R6416:Frem2 UTSW 3 53572378 missense probably benign 0.01
R6595:Frem2 UTSW 3 53549784 missense probably damaging 1.00
R6665:Frem2 UTSW 3 53654656 missense probably damaging 1.00
R6708:Frem2 UTSW 3 53585501 missense probably benign 0.00
R6751:Frem2 UTSW 3 53653665 missense probably damaging 1.00
R6787:Frem2 UTSW 3 53654323 missense probably benign 0.01
R6913:Frem2 UTSW 3 53516821 missense probably damaging 1.00
R6916:Frem2 UTSW 3 53547688 missense probably damaging 1.00
R7017:Frem2 UTSW 3 53519602 missense probably benign 0.02
R7083:Frem2 UTSW 3 53537493 missense probably damaging 0.99
R7108:Frem2 UTSW 3 53653513 missense probably damaging 1.00
R7133:Frem2 UTSW 3 53572339 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AACATCGGTATTTGGGCGTTC -3'
(R):5'- CGCTTATTCTACAAAAGAGGCCG -3'

Sequencing Primer
(F):5'- GGCGTTCCTCGAAGTCCATC -3'
(R):5'- CATCTTCTCCACGGAAAAC -3'
Posted On2016-04-01