Incidental Mutation 'R4280:Arl6ip1'
ID377763
Institutional Source Beutler Lab
Gene Symbol Arl6ip1
Ensembl Gene ENSMUSG00000030654
Gene NameADP-ribosylation factor-like 6 interacting protein 1
SynonymsAIP-6, ARMER
MMRRC Submission 041648-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.512) question?
Stock #R4280 (G1)
Quality Score212
Status Validated
Chromosome7
Chromosomal Location118118891-118129662 bp(-) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) AAAATAAATAAATAAATAAATAAATA to AAAATAAATAAATAAATAAATAAATAAATA at 118121899 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032888] [ENSMUST00000203154] [ENSMUST00000204005] [ENSMUST00000206491]
Predicted Effect probably benign
Transcript: ENSMUST00000032888
SMART Domains Protein: ENSMUSP00000032888
Gene: ENSMUSG00000030654

DomainStartEndE-ValueType
transmembrane domain 42 61 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 136 153 N/A INTRINSIC
transmembrane domain 158 180 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203154
Predicted Effect probably benign
Transcript: ENSMUST00000204005
SMART Domains Protein: ENSMUSP00000145418
Gene: ENSMUSG00000030654

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205182
Predicted Effect probably benign
Transcript: ENSMUST00000206491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206536
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ARL6ip family and encodes a transmembrane protein that is predominantly localized to intracytoplasmic membranes. It is highly expressed in early myeloid progenitor cells and thought to be involved in protein transport, membrane trafficking, or cell signaling during hematopoietic maturation. Mutations in this gene are associated with spastic paraplegia 61 (SPG61). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T C 17: 47,413,855 M17V probably benign Het
1700021F05Rik A T 10: 43,532,909 F79L probably benign Het
1700057G04Rik T C 9: 92,343,648 Y8H possibly damaging Het
4930415L06Rik A T X: 89,932,499 W31R probably damaging Het
Arhgap32 T C 9: 32,259,889 C1322R probably damaging Het
Arvcf G A 16: 18,397,991 R292H probably damaging Het
Ccdc102a C A 8: 94,907,816 G382* probably null Het
Cd274 A T 19: 29,380,471 M188L probably benign Het
Cep76 T A 18: 67,640,159 D23V probably benign Het
Clec12a A G 6: 129,363,929 Y224C probably damaging Het
Cplx2 A G 13: 54,379,564 E87G probably damaging Het
Ctr9 A G 7: 111,046,723 probably benign Het
Dgat2 A G 7: 99,158,997 I157T probably damaging Het
Epha1 G T 6: 42,365,052 P355T probably damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Gm13078 A G 4: 143,726,022 T8A possibly damaging Het
Gmip T A 8: 69,813,601 probably benign Het
Hephl1 A G 9: 15,112,034 V24A probably benign Het
Itgb4 T A 11: 115,990,935 M771K probably damaging Het
Mov10 A C 3: 104,799,779 F635V probably damaging Het
Olfr1130 A G 2: 87,608,251 T288A possibly damaging Het
Olfr1431 A G 19: 12,209,938 Y124C probably damaging Het
Pbrm1 T C 14: 31,107,312 probably null Het
Plxnd1 C A 6: 115,956,094 probably benign Het
Plxnd1 A T 6: 115,956,095 probably null Het
Pnma5 T C X: 73,035,430 M549V probably benign Het
Polq C A 16: 37,082,057 Q2205K probably damaging Het
Psma8 T A 18: 14,721,235 D57E probably benign Het
Rbm47 T C 5: 66,026,177 Y361C probably damaging Het
Rec8 A G 14: 55,618,634 H11R probably damaging Het
Ric1 A G 19: 29,586,550 Y568C probably damaging Het
Rrp36 G A 17: 46,672,376 T104I probably damaging Het
Rrs1 G A 1: 9,546,139 G206S probably damaging Het
Scgb2b6 A G 7: 31,618,942 noncoding transcript Het
Skint5 T A 4: 113,942,552 K126I probably damaging Het
Slc38a10 C T 11: 120,137,878 G202D probably damaging Het
Supt5 G A 7: 28,317,073 R761W probably damaging Het
Tmtc2 A G 10: 105,348,433 probably null Het
Tob1 T C 11: 94,214,322 V228A probably benign Het
Traj44 T C 14: 54,173,691 probably benign Het
Trps1 G A 15: 50,846,082 L291F probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ush2a A G 1: 188,578,461 Q2078R probably benign Het
Zbtb24 T C 10: 41,464,920 S649P probably benign Het
Zfp28 A T 7: 6,393,701 Q378H probably benign Het
Zfp429 A C 13: 67,390,795 C177G probably damaging Het
Other mutations in Arl6ip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1412:Arl6ip1 UTSW 7 118120368 missense possibly damaging 0.96
R4155:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4156:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4157:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4201:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4206:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4271:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4276:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4277:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4278:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4281:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4283:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4330:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4502:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4503:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4547:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4548:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4580:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4604:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4774:Arl6ip1 UTSW 7 118121985 missense probably damaging 1.00
R4804:Arl6ip1 UTSW 7 118129552 utr 5 prime probably null
R4805:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4807:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R6211:Arl6ip1 UTSW 7 118127250 missense probably benign 0.44
R6651:Arl6ip1 UTSW 7 118129485 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGCTACCTTCCCAGTTAGCAC -3'
(R):5'- GGGAGGTCAAGAGTCTTAGCTG -3'

Sequencing Primer
(F):5'- CCAGTTAGCACTTCCCACC -3'
(R):5'- GTGGAAACGCCTCTTTTC -3'
Posted On2016-04-01