Incidental Mutation 'R4436:Adamts16'
ID377822
Institutional Source Beutler Lab
Gene Symbol Adamts16
Ensembl Gene ENSMUSG00000049538
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 16
Synonyms
MMRRC Submission 041702-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4436 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location70727802-70841811 bp(-) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) G to A at 70779518 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080145] [ENSMUST00000109694] [ENSMUST00000123552]
Predicted Effect probably benign
Transcript: ENSMUST00000080145
SMART Domains Protein: ENSMUSP00000079041
Gene: ENSMUSG00000049538

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 57 203 7.8e-34 PFAM
Pfam:Reprolysin_5 287 470 2.9e-13 PFAM
Pfam:Reprolysin_4 289 489 1.2e-8 PFAM
Pfam:Reprolysin 289 493 5.4e-32 PFAM
Pfam:Reprolysin_2 306 483 3.7e-10 PFAM
Pfam:Reprolysin_3 310 442 6.4e-11 PFAM
TSP1 587 639 1.43e-14 SMART
Pfam:ADAM_spacer1 744 856 1.3e-37 PFAM
TSP1 872 926 3.48e0 SMART
TSP1 928 985 4.84e-3 SMART
TSP1 987 1046 1.49e-3 SMART
TSP1 1052 1113 3.19e-2 SMART
TSP1 1127 1179 7.68e-6 SMART
Pfam:PLAC 1188 1218 2.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109694
SMART Domains Protein: ENSMUSP00000105316
Gene: ENSMUSG00000049538

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 56 203 2.2e-32 PFAM
Pfam:Reprolysin_5 287 470 1.8e-13 PFAM
Pfam:Reprolysin_4 289 489 7.3e-9 PFAM
Pfam:Reprolysin 289 493 4.6e-33 PFAM
Pfam:Reprolysin_2 306 483 4.1e-10 PFAM
Pfam:Reprolysin_3 310 442 3.3e-10 PFAM
TSP1 587 639 1.43e-14 SMART
Pfam:ADAM_spacer1 744 856 1.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123552
SMART Domains Protein: ENSMUSP00000122031
Gene: ENSMUSG00000049538

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 56 203 5.9e-33 PFAM
Pfam:Reprolysin_5 287 470 5.1e-14 PFAM
Pfam:Reprolysin_4 289 489 2.2e-9 PFAM
Pfam:Reprolysin 289 493 1.2e-33 PFAM
Pfam:Reprolysin_2 306 483 1.2e-10 PFAM
Pfam:Reprolysin_3 310 442 9.7e-11 PFAM
TSP1 587 639 1.43e-14 SMART
Meta Mutation Damage Score 0.308 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is co-expressed with the Wilms tumor protein, Wt1, in the developing glomeruli of embryonic kidneys. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 T C 1: 38,209,687 I779V possibly damaging Het
Apopt1 T A 12: 111,751,208 D167E probably benign Het
Asap1 T G 15: 64,349,843 D15A probably benign Het
Ascc2 A G 11: 4,656,305 D193G probably damaging Het
Bcl2a1d A T 9: 88,731,700 M7K probably benign Het
Ccdc85a T C 11: 28,576,457 T384A probably benign Het
Cd86 T C 16: 36,620,832 N91S probably benign Het
Cdk17 T A 10: 93,211,896 probably null Het
Cemip T C 7: 83,987,429 D332G probably null Het
Ces2f G A 8: 104,953,156 R427H probably benign Het
Clec4a2 G A 6: 123,128,054 probably null Het
Coq9 T C 8: 94,853,115 F198L probably benign Het
Ddx24 C A 12: 103,423,974 A253S probably damaging Het
Esyt3 A T 9: 99,358,025 probably benign Het
Fat2 C A 11: 55,296,198 G1274V probably damaging Het
Ggn A T 7: 29,171,551 T132S probably damaging Het
Gm11568 T A 11: 99,858,595 C209S unknown Het
Gm6931 T A 16: 49,424,862 noncoding transcript Het
Gm8251 T C 1: 44,056,116 I1941V probably benign Het
Gpr20 C T 15: 73,695,800 V247I probably benign Het
Grm8 A T 6: 27,761,238 V329E possibly damaging Het
Gtf2ird2 T C 5: 134,194,969 L114P possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hivep3 C T 4: 120,095,923 P479S probably benign Het
Igkv6-20 A G 6: 70,336,120 V23A probably damaging Het
Ikbip T A 10: 91,101,889 N141K probably damaging Het
Krt77 A T 15: 101,865,469 V250E probably damaging Het
Ltn1 A T 16: 87,405,614 C1050S probably benign Het
Macf1 T C 4: 123,527,342 I40V probably benign Het
Mrvi1 T C 7: 110,876,917 E815G probably damaging Het
Olfr725 T C 14: 50,034,830 D191G probably damaging Het
Olfr753-ps1 A G 17: 37,169,836 F271L probably benign Het
Pi4ka T C 16: 17,282,382 M1885V probably damaging Het
Plek A G 11: 16,992,972 Y107H probably damaging Het
Ppp1r15a C T 7: 45,524,779 V202M probably damaging Het
Ppp1r3e C A 14: 54,876,550 A222S probably benign Het
Rac2 G T 15: 78,570,743 Y32* probably null Het
Sdf4 T G 4: 156,008,947 probably null Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Spic T A 10: 88,676,955 R111S probably benign Het
Ssh3 A G 19: 4,265,366 F315L probably damaging Het
Ttn T C 2: 76,764,909 K11972R probably damaging Het
Tubd1 C T 11: 86,548,919 S30F probably benign Het
Vmn1r17 G C 6: 57,360,734 I166M possibly damaging Het
Vmn2r94 T C 17: 18,258,383 Y34C probably damaging Het
Xpo7 G A 14: 70,669,429 T945M probably damaging Het
Zfp316 C A 5: 143,254,048 A739S probably damaging Het
Zswim3 T A 2: 164,820,643 C348S probably benign Het
Other mutations in Adamts16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Adamts16 APN 13 70795484 missense probably benign 0.01
IGL01338:Adamts16 APN 13 70836115 missense probably damaging 1.00
IGL01663:Adamts16 APN 13 70793141 missense probably benign 0.01
IGL01804:Adamts16 APN 13 70800961 nonsense probably null
IGL01874:Adamts16 APN 13 70768704 missense possibly damaging 0.79
IGL01984:Adamts16 APN 13 70787147 missense probably damaging 1.00
IGL02305:Adamts16 APN 13 70772929 missense probably damaging 1.00
IGL02350:Adamts16 APN 13 70738585 missense probably benign 0.00
IGL02357:Adamts16 APN 13 70738585 missense probably benign 0.00
IGL02429:Adamts16 APN 13 70787170 splice site probably benign
IGL02450:Adamts16 APN 13 70836300 missense probably damaging 0.97
IGL02807:Adamts16 APN 13 70738778 critical splice donor site probably null
IGL03356:Adamts16 APN 13 70753291 missense probably benign 0.00
swap UTSW 13 70779518 critical splice donor site probably benign
switcheroo UTSW 13 70800954 missense probably benign
R0046:Adamts16 UTSW 13 70763460 missense probably benign 0.00
R0046:Adamts16 UTSW 13 70763460 missense probably benign 0.00
R0201:Adamts16 UTSW 13 70779644 missense possibly damaging 0.69
R0326:Adamts16 UTSW 13 70779611 missense possibly damaging 0.89
R0336:Adamts16 UTSW 13 70791794 critical splice donor site probably benign
R0369:Adamts16 UTSW 13 70779552 missense possibly damaging 0.94
R0422:Adamts16 UTSW 13 70738955 missense probably damaging 1.00
R0507:Adamts16 UTSW 13 70768647 missense probably benign
R0524:Adamts16 UTSW 13 70800894 missense probably benign 0.00
R0590:Adamts16 UTSW 13 70800954 missense probably benign
R0734:Adamts16 UTSW 13 70738481 splice site probably benign
R0787:Adamts16 UTSW 13 70738829 missense probably damaging 1.00
R0826:Adamts16 UTSW 13 70768692 missense possibly damaging 0.64
R0920:Adamts16 UTSW 13 70763561 splice site probably benign
R1027:Adamts16 UTSW 13 70767802 missense probably damaging 1.00
R1462:Adamts16 UTSW 13 70836134 missense probably benign 0.00
R1462:Adamts16 UTSW 13 70836134 missense probably benign 0.00
R1535:Adamts16 UTSW 13 70791794 critical splice donor site probably null
R1617:Adamts16 UTSW 13 70798035 missense probably benign 0.09
R1700:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R1734:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R1736:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R1737:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R1738:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R1746:Adamts16 UTSW 13 70779598 synonymous probably null
R1869:Adamts16 UTSW 13 70735747 missense probably damaging 1.00
R1944:Adamts16 UTSW 13 70791886 missense possibly damaging 0.93
R1997:Adamts16 UTSW 13 70753267 missense probably benign 0.39
R2018:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R2135:Adamts16 UTSW 13 70801007 missense probably damaging 1.00
R2219:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R2228:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R3410:Adamts16 UTSW 13 70753226 missense probably benign 0.00
R3411:Adamts16 UTSW 13 70753226 missense probably benign 0.00
R3842:Adamts16 UTSW 13 70738891 missense possibly damaging 0.92
R4117:Adamts16 UTSW 13 70767992 missense probably benign 0.01
R4435:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4526:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4552:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4555:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4556:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4557:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4579:Adamts16 UTSW 13 70779624 missense probably damaging 1.00
R4639:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4640:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4641:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4642:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4672:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R5350:Adamts16 UTSW 13 70753196 nonsense probably null
R5464:Adamts16 UTSW 13 70761749 missense probably benign 0.01
R5613:Adamts16 UTSW 13 70730134 missense probably benign 0.01
R5667:Adamts16 UTSW 13 70836375 nonsense probably null
R5735:Adamts16 UTSW 13 70836218 missense possibly damaging 0.94
R5762:Adamts16 UTSW 13 70738498 missense probably damaging 1.00
R5907:Adamts16 UTSW 13 70728910 missense probably damaging 1.00
R6169:Adamts16 UTSW 13 70770274 nonsense probably null
R6351:Adamts16 UTSW 13 70836203 missense probably damaging 1.00
R6665:Adamts16 UTSW 13 70779570 missense probably damaging 1.00
R6913:Adamts16 UTSW 13 70728898 missense possibly damaging 0.94
R6982:Adamts16 UTSW 13 70768520 intron probably null
R6996:Adamts16 UTSW 13 70798038 critical splice acceptor site probably null
R7313:Adamts16 UTSW 13 70772955 nonsense probably null
R7356:Adamts16 UTSW 13 70836280 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTGAGCTCCCAAATGAAAGC -3'
(R):5'- TCATCAAATTGCATGGGAAAGG -3'

Sequencing Primer
(F):5'- GTGAGCTCCCAAATGAAAGCTGATAC -3'
(R):5'- GGTCATATATCCCTTGGTAACTCATC -3'
Posted On2016-04-11