Incidental Mutation 'R4493:Zfp946'
ID377825
Institutional Source Beutler Lab
Gene Symbol Zfp946
Ensembl Gene ENSMUSG00000071266
Gene Namezinc finger protein 946
Synonyms
MMRRC Submission 041748-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4493 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location22424222-22456689 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 22451086 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088763] [ENSMUST00000120222] [ENSMUST00000167740]
Predicted Effect probably benign
Transcript: ENSMUST00000088763
SMART Domains Protein: ENSMUSP00000086141
Gene: ENSMUSG00000071266

DomainStartEndE-ValueType
KRAB 13 71 4.49e-17 SMART
ZnF_C2H2 186 208 3.83e-2 SMART
ZnF_C2H2 242 264 1.6e-4 SMART
ZnF_C2H2 270 292 1.45e-2 SMART
ZnF_C2H2 298 320 5.99e-4 SMART
ZnF_C2H2 326 348 2.15e-5 SMART
ZnF_C2H2 354 376 2.4e-3 SMART
ZnF_C2H2 382 404 1.28e-3 SMART
ZnF_C2H2 410 432 2.09e-3 SMART
ZnF_C2H2 438 460 9.44e-2 SMART
ZnF_C2H2 466 488 3.44e-4 SMART
ZnF_C2H2 494 516 1.5e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000120222
SMART Domains Protein: ENSMUSP00000113244
Gene: ENSMUSG00000071266

DomainStartEndE-ValueType
KRAB 13 71 4.49e-17 SMART
ZnF_C2H2 186 208 3.83e-2 SMART
ZnF_C2H2 242 264 1.6e-4 SMART
ZnF_C2H2 270 292 1.45e-2 SMART
ZnF_C2H2 298 320 5.99e-4 SMART
ZnF_C2H2 326 348 2.15e-5 SMART
ZnF_C2H2 354 376 2.4e-3 SMART
ZnF_C2H2 382 404 1.28e-3 SMART
ZnF_C2H2 410 432 2.09e-3 SMART
ZnF_C2H2 438 460 9.44e-2 SMART
ZnF_C2H2 466 488 3.44e-4 SMART
ZnF_C2H2 494 516 1.5e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141831
Predicted Effect probably benign
Transcript: ENSMUST00000167740
SMART Domains Protein: ENSMUSP00000132940
Gene: ENSMUSG00000071266

DomainStartEndE-ValueType
KRAB 13 71 4.49e-17 SMART
ZnF_C2H2 186 208 3.83e-2 SMART
ZnF_C2H2 242 264 1.6e-4 SMART
ZnF_C2H2 270 292 1.45e-2 SMART
ZnF_C2H2 298 320 5.99e-4 SMART
ZnF_C2H2 326 348 2.15e-5 SMART
ZnF_C2H2 354 376 2.4e-3 SMART
ZnF_C2H2 382 404 1.28e-3 SMART
ZnF_C2H2 410 432 2.09e-3 SMART
ZnF_C2H2 438 460 9.44e-2 SMART
ZnF_C2H2 466 488 3.44e-4 SMART
ZnF_C2H2 494 516 1.5e-4 SMART
Meta Mutation Damage Score 0.6316 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 94% (45/48)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1b T C 2: 24,652,938 T1301A probably damaging Het
Ccdc141 A G 2: 77,132,297 V101A probably damaging Het
Ccdc146 T C 5: 21,303,193 E619G possibly damaging Het
Cmya5 T C 13: 93,094,065 E1505G probably benign Het
Cngb3 C A 4: 19,367,778 P229Q probably damaging Het
Ctnna2 A G 6: 76,981,848 V461A probably damaging Het
D430041D05Rik T C 2: 104,256,339 D764G probably benign Het
Dgki T C 6: 36,974,861 probably benign Het
Dhx36 A T 3: 62,488,504 probably benign Het
Gcn1l1 T C 5: 115,594,144 I1006T probably benign Het
Glt8d2 T A 10: 82,664,713 M20L possibly damaging Het
Greb1 C A 12: 16,698,610 G1122V probably benign Het
Hmcn1 A T 1: 150,701,899 I2037N probably damaging Het
Hspa4l A G 3: 40,768,002 I340V possibly damaging Het
Itpr3 A G 17: 27,104,612 K1204E probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Maats1 T C 16: 38,341,768 T4A probably benign Het
Mcph1 T A 8: 18,631,736 C296* probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Naga A G 15: 82,332,514 F259S probably damaging Het
Nes A G 3: 87,976,813 E793G probably damaging Het
Nfkb2 A G 19: 46,308,439 D316G probably damaging Het
Pcdha4 A T 18: 36,954,591 Y609F possibly damaging Het
Pgam1 C T 19: 41,915,776 A104V possibly damaging Het
Piezo2 T C 18: 63,114,063 I525V probably damaging Het
Pold1 A G 7: 44,537,708 V683A probably damaging Het
Poteg T C 8: 27,480,097 V316A possibly damaging Het
Ppih A T 4: 119,310,845 N156K probably damaging Het
Prep T C 10: 45,120,819 F398L probably benign Het
Prlhr A T 19: 60,467,081 M349K probably benign Het
Rtp4 A T 16: 23,610,077 H30L probably benign Het
Stkld1 A G 2: 26,946,626 N268S probably benign Het
Syt6 A G 3: 103,585,630 E66G probably damaging Het
Tas2r129 A G 6: 132,951,354 I85V probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tprn T C 2: 25,268,892 S643P probably damaging Het
Trrap T C 5: 144,831,048 V2605A probably benign Het
Vmn1r230 T A 17: 20,846,601 N17K probably benign Het
Xkrx T C X: 134,150,996 N302S possibly damaging Het
Other mutations in Zfp946
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Zfp946 APN 17 22454662 missense possibly damaging 0.88
IGL01869:Zfp946 APN 17 22454703 missense probably benign 0.45
IGL02037:Zfp946 APN 17 22453488 missense probably damaging 1.00
IGL03111:Zfp946 APN 17 22454556 missense possibly damaging 0.76
R0324:Zfp946 UTSW 17 22454436 missense probably benign 0.41
R1252:Zfp946 UTSW 17 22453579 critical splice donor site probably null
R1733:Zfp946 UTSW 17 22453557 missense probably damaging 1.00
R1971:Zfp946 UTSW 17 22455425 missense probably damaging 1.00
R2064:Zfp946 UTSW 17 22455465 missense probably damaging 1.00
R2106:Zfp946 UTSW 17 22453485 missense probably benign 0.30
R2216:Zfp946 UTSW 17 22454716 missense possibly damaging 0.49
R3899:Zfp946 UTSW 17 22454550 missense probably benign 0.05
R3924:Zfp946 UTSW 17 22455701 missense probably benign 0.06
R4125:Zfp946 UTSW 17 22454567 nonsense probably null
R4694:Zfp946 UTSW 17 22455711 missense probably benign 0.16
R4924:Zfp946 UTSW 17 22455521 missense probably damaging 1.00
R4939:Zfp946 UTSW 17 22455437 missense probably damaging 1.00
R5020:Zfp946 UTSW 17 22455603 missense probably benign 0.03
R5248:Zfp946 UTSW 17 22454466 missense probably benign 0.12
R5547:Zfp946 UTSW 17 22454892 missense probably benign 0.00
R5551:Zfp946 UTSW 17 22455384 missense probably damaging 1.00
R5573:Zfp946 UTSW 17 22454695 nonsense probably null
R6048:Zfp946 UTSW 17 22454840 missense probably benign 0.03
R6080:Zfp946 UTSW 17 22455109 missense probably benign 0.00
R6198:Zfp946 UTSW 17 22454915 missense probably damaging 1.00
R6332:Zfp946 UTSW 17 22454538 missense probably damaging 1.00
R6766:Zfp946 UTSW 17 22455771 missense probably benign 0.01
R7132:Zfp946 UTSW 17 22454663 missense probably benign 0.41
R7248:Zfp946 UTSW 17 22453508 nonsense probably null
X0065:Zfp946 UTSW 17 22455513 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGACTGTACTCATTTTCCAAGCTTC -3'
(R):5'- GCTGTGCTTGTCCCATTATAAG -3'

Sequencing Primer
(F):5'- AGCTTCACTTAATATCTCATTCCATG -3'
(R):5'- GCTTGTCCCATTATAAGTGAAAAATC -3'
Posted On2016-04-11