Incidental Mutation 'R4516:Gm10722'
ID377827
Institutional Source Beutler Lab
Gene Symbol Gm10722
Ensembl Gene ENSMUSG00000091028
Gene Namepredicted gene 10722
Synonyms
MMRRC Submission 041760-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.615) question?
Stock #R4516 (G1)
Quality Score30
Status Validated
Chromosome9
Chromosomal Location3000922-3002330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3000937 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 6 (C6R)
Ref Sequence ENSEMBL: ENSMUSP00000132394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151376] [ENSMUST00000177722] [ENSMUST00000178077] [ENSMUST00000178348] [ENSMUST00000179881]
Predicted Effect probably benign
Transcript: ENSMUST00000151376
AA Change: C6R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132394
Gene: ENSMUSG00000091028
AA Change: C6R

DomainStartEndE-ValueType
internal_repeat_2 8 50 1.25e-5 PROSPERO
internal_repeat_1 11 88 6.98e-39 PROSPERO
internal_repeat_2 66 108 1.25e-5 PROSPERO
internal_repeat_1 89 166 6.98e-39 PROSPERO
transmembrane domain 187 209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177722
SMART Domains Protein: ENSMUSP00000136598
Gene: ENSMUSG00000096385

DomainStartEndE-ValueType
internal_repeat_1 1 19 1.14e-8 PROSPERO
transmembrane domain 26 48 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
internal_repeat_1 118 136 1.14e-8 PROSPERO
transmembrane domain 156 178 N/A INTRINSIC
transmembrane domain 200 222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178077
SMART Domains Protein: ENSMUSP00000136761
Gene: ENSMUSG00000096385

DomainStartEndE-ValueType
internal_repeat_1 1 19 4.71e-8 PROSPERO
transmembrane domain 26 48 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
internal_repeat_1 118 136 4.71e-8 PROSPERO
transmembrane domain 156 178 N/A INTRINSIC
transmembrane domain 200 222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178348
SMART Domains Protein: ENSMUSP00000137273
Gene: ENSMUSG00000096385

DomainStartEndE-ValueType
internal_repeat_1 1 48 1.34e-9 PROSPERO
transmembrane domain 77 99 N/A INTRINSIC
internal_repeat_1 117 165 1.34e-9 PROSPERO
transmembrane domain 196 218 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179881
SMART Domains Protein: ENSMUSP00000136541
Gene: ENSMUSG00000096385

DomainStartEndE-ValueType
internal_repeat_1 1 46 5.29e-7 PROSPERO
transmembrane domain 53 72 N/A INTRINSIC
transmembrane domain 77 99 N/A INTRINSIC
internal_repeat_1 117 182 5.29e-7 PROSPERO
transmembrane domain 195 217 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181242
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.9%
Validation Efficiency 86% (51/59)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,517,200 probably benign Het
4930452B06Rik A T 14: 8,536,609 D199E probably damaging Het
4932438A13Rik T C 3: 36,895,311 S369P possibly damaging Het
Bean1 T C 8: 104,215,154 S211P probably damaging Het
Camta1 A G 4: 151,144,720 S552P possibly damaging Het
Cdh11 T C 8: 102,673,962 T125A possibly damaging Het
Cdk5rap2 A T 4: 70,276,715 probably null Het
Cenpc1 A G 5: 86,047,587 S108P possibly damaging Het
Cfap44 T A 16: 44,473,864 Y224* probably null Het
Cfap46 G A 7: 139,660,082 probably benign Het
Cntrl G A 2: 35,127,981 V468I probably benign Het
Col6a6 C T 9: 105,698,949 V2071I possibly damaging Het
Coq7 A T 7: 118,509,907 L306Q unknown Het
D7Ertd443e C G 7: 134,293,328 Q591H probably damaging Het
Dchs1 C T 7: 105,754,852 V2828M probably damaging Het
Dzank1 T A 2: 144,510,122 probably benign Het
Elmo1 C T 13: 20,282,914 T235I probably benign Het
Elp3 A T 14: 65,547,877 F492I possibly damaging Het
Espl1 A G 15: 102,323,236 S90G probably benign Het
Fbxl20 T C 11: 98,095,235 probably benign Het
Gm16286 G A 18: 80,211,576 M28I probably benign Het
Got1 T C 19: 43,504,841 Y243C probably damaging Het
Hipk1 G T 3: 103,750,372 H799N probably damaging Het
Kif21a A T 15: 90,971,142 M673K probably benign Het
Lama3 T A 18: 12,495,358 D1502E probably damaging Het
Limk1 A G 5: 134,676,786 probably benign Het
Myo5b A G 18: 74,625,674 Y242C probably damaging Het
Ncbp1 T C 4: 46,157,824 V354A probably damaging Het
Ncoa2 T C 1: 13,146,906 D1380G probably damaging Het
Ntng1 A G 3: 109,935,013 I148T probably damaging Het
Oas1d A T 5: 120,919,170 T280S probably damaging Het
Olfr1229 T A 2: 89,282,843 M118L probably benign Het
Olfr389 C T 11: 73,777,040 G96S probably benign Het
Pax7 T G 4: 139,780,793 D307A probably benign Het
Pdxdc1 G A 16: 13,838,346 Q621* probably null Het
Rab29 A T 1: 131,867,731 Y27F possibly damaging Het
Rab3gap2 G A 1: 185,267,068 V991I probably benign Het
Ric1 A G 19: 29,570,765 T278A probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc47a1 T C 11: 61,344,513 H498R probably benign Het
Tas2r116 T C 6: 132,856,150 L238P probably damaging Het
Tigd5 A T 15: 75,910,515 R252* probably null Het
Tlr6 A G 5: 64,954,904 F220S possibly damaging Het
Tmem106b C T 6: 13,075,099 T95I probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn1r174 A G 7: 23,754,343 I145V probably benign Het
Vps26a T C 10: 62,468,345 M116V probably damaging Het
Other mutations in Gm10722
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Gm10722 APN 9 3002230 missense probably damaging 0.98
PIT4131001:Gm10722 UTSW 9 3001414 unclassified probably benign
PIT4142001:Gm10722 UTSW 9 3001350 missense probably benign
R0148:Gm10722 UTSW 9 3001405 missense probably null
R0335:Gm10722 UTSW 9 3001048 missense probably null
R4162:Gm10722 UTSW 9 3001041 missense probably benign
R4327:Gm10722 UTSW 9 3000937 missense probably benign
R4449:Gm10722 UTSW 9 3001041 missense probably benign
R4807:Gm10722 UTSW 9 3000937 missense probably benign
R4998:Gm10722 UTSW 9 3001041 missense probably benign
R5017:Gm10722 UTSW 9 3000937 missense probably benign
R5021:Gm10722 UTSW 9 3001041 missense probably benign
R5075:Gm10722 UTSW 9 3001041 missense probably benign
R5135:Gm10722 UTSW 9 3000937 missense probably benign
R5152:Gm10722 UTSW 9 3001041 missense probably benign
R5226:Gm10722 UTSW 9 3000937 missense probably benign
R5482:Gm10722 UTSW 9 3001041 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGGTCTTACAGGGTGCATT -3'
(R):5'- CACTTTAGGACATGAAATATGGCGA -3'

Sequencing Primer
(F):5'- GCCATATTCCACGTCCTATAGTG -3'
(R):5'- TCCACTGTAGGACATGGAATATGGC -3'
Posted On2016-04-11