Incidental Mutation 'R4467:Stag2'
ID377835
Institutional Source Beutler Lab
Gene Symbol Stag2
Ensembl Gene ENSMUSG00000025862
Gene Namestromal antigen 2
Synonymsnuclear protein SA2, SA-2, 9230105L23Rik, SAP2, B230112I07Rik
MMRRC Submission 041724-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R4467 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location42149317-42277185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42233872 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 400 (S400G)
Ref Sequence ENSEMBL: ENSMUSP00000110725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069619] [ENSMUST00000115072] [ENSMUST00000115073]
Predicted Effect probably benign
Transcript: ENSMUST00000069619
AA Change: S400G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000063250
Gene: ENSMUSG00000025862
AA Change: S400G

DomainStartEndE-ValueType
low complexity region 32 68 N/A INTRINSIC
Pfam:STAG 154 273 3e-50 PFAM
SCOP:d1b3ua_ 275 439 2e-3 SMART
low complexity region 501 513 N/A INTRINSIC
low complexity region 1096 1101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115072
AA Change: S400G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110724
Gene: ENSMUSG00000025862
AA Change: S400G

DomainStartEndE-ValueType
low complexity region 32 68 N/A INTRINSIC
Pfam:STAG 154 273 3e-50 PFAM
SCOP:d1b3ua_ 275 439 2e-3 SMART
low complexity region 501 513 N/A INTRINSIC
low complexity region 1096 1101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115073
AA Change: S400G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000110725
Gene: ENSMUSG00000025862
AA Change: S400G

DomainStartEndE-ValueType
low complexity region 32 68 N/A INTRINSIC
Pfam:STAG 157 271 6.3e-41 PFAM
SCOP:d1b3ua_ 275 439 2e-3 SMART
low complexity region 501 513 N/A INTRINSIC
low complexity region 1096 1101 N/A INTRINSIC
coiled coil region 1169 1189 N/A INTRINSIC
Meta Mutation Damage Score 0.0688 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the cohesin complex, which regulates the separation of sister chromatids during cell division. Targeted inactivation of this gene results in chromatid cohesion defects and aneuploidy, suggesting that genetic disruption of cohesin is a cause of aneuploidy in human cancer. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Knockdown of expression of this gene results in lineage skewing of hematopoietic stem cells and myeloproliferative disorders in aged mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
4930402H24Rik A G 2: 130,767,647 I372T probably damaging Het
Atg4a-ps A G 3: 103,645,855 Y57H probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bms1 G A 6: 118,383,847 T1220I probably damaging Het
Brat1 T C 5: 140,705,071 probably benign Het
Casc1 A T 6: 145,183,218 probably null Het
Cds2 T A 2: 132,294,446 Y39* probably null Het
Chrnd T A 1: 87,197,377 L384Q probably damaging Het
Cpa3 A T 3: 20,228,817 Y155* probably null Het
Crlf1 G A 8: 70,500,956 W260* probably null Het
Cux1 C G 5: 136,312,722 E605D probably damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Dmtf1 T C 5: 9,136,085 N167S probably damaging Het
Dtx2 T A 5: 136,012,076 W112R probably damaging Het
Elf3 A G 1: 135,256,844 I138T probably damaging Het
F11 T A 8: 45,241,474 I617F probably damaging Het
Fdps A T 3: 89,100,786 D8E possibly damaging Het
Fzd10 C A 5: 128,601,276 T20K probably benign Het
Gm9978 T A 10: 78,486,916 noncoding transcript Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Has1 C T 17: 17,843,995 V461M probably benign Het
Hdac3 C T 18: 37,952,513 G80D probably benign Het
Klk12 A T 7: 43,773,383 R245W probably damaging Het
Lamp5 A G 2: 136,059,020 I47V probably damaging Het
Olfr786 T C 10: 129,437,064 I84T probably benign Het
Ovgp1 A G 3: 105,977,711 D122G probably benign Het
Piezo1 T C 8: 122,486,396 E1875G probably benign Het
Pih1d1 A G 7: 45,158,497 M132V possibly damaging Het
Pon2 C T 6: 5,267,021 A241T probably benign Het
Prkce A G 17: 86,619,911 I538V possibly damaging Het
Rab36 C T 10: 75,052,043 R249* probably null Het
Rps6kl1 C T 12: 85,147,808 A110T probably damaging Het
Rsad1 T C 11: 94,544,530 T244A probably benign Het
Slc22a7 T C 17: 46,432,510 I532V probably benign Het
Slc2a7 T C 4: 150,163,274 V377A possibly damaging Het
Slx4 A G 16: 3,989,055 V508A possibly damaging Het
Stat6 T G 10: 127,651,228 I201M probably damaging Het
Stim2 T C 5: 54,116,194 probably null Het
Tbc1d9 A G 8: 83,210,478 Y63C probably damaging Het
Tctn2 T C 5: 124,620,189 noncoding transcript Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ubr5 T A 15: 38,004,336 T1282S probably damaging Het
Ufl1 A T 4: 25,254,806 I550N probably damaging Het
Uty A G Y: 1,158,372 V557A possibly damaging Het
Vmn1r54 T C 6: 90,269,271 S56P probably damaging Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Stag2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Stag2 APN X 42247015 missense probably benign 0.17
IGL02379:Stag2 APN X 42250597 missense probably benign 0.00
IGL02501:Stag2 APN X 42271325 splice site probably benign
R0194:Stag2 UTSW X 42206137 splice site probably benign
R4057:Stag2 UTSW X 42224942 missense probably damaging 1.00
R4465:Stag2 UTSW X 42233872 missense probably benign 0.00
R4466:Stag2 UTSW X 42233872 missense probably benign 0.00
R5007:Stag2 UTSW X 42266253 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GTGCATCATAGCAGTCATCTTTCATC -3'
(R):5'- AGATAGTGCTTGCATCAAACCAAG -3'

Sequencing Primer
(F):5'- AGCAGTCATCTTTCATCTTGATACAC -3'
(R):5'- GCTTGCATCAAACCAAGTAAATATTC -3'
Posted On2016-04-11