Incidental Mutation 'R4902:Tmem50a'
ID377864
Institutional Source Beutler Lab
Gene Symbol Tmem50a
Ensembl Gene ENSMUSG00000028822
Gene Nametransmembrane protein 50A
SynonymsSmp1, CAM, 3200001F09Rik
MMRRC Submission 042505-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R4902 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location134897849-134915024 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134909706 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 38 (I38T)
Ref Sequence ENSEMBL: ENSMUSP00000101489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030626] [ENSMUST00000105863]
Predicted Effect probably damaging
Transcript: ENSMUST00000030626
AA Change: I38T

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030626
Gene: ENSMUSG00000028822
AA Change: I38T

DomainStartEndE-ValueType
Pfam:UPF0220 1 157 1.9e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105863
AA Change: I38T

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101489
Gene: ENSMUSG00000028822
AA Change: I38T

DomainStartEndE-ValueType
Pfam:UPF0220 5 156 2.4e-50 PFAM
Meta Mutation Damage Score 0.298 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located in the RH gene locus, between the RHD and RHCE genes. The function of its protein product is unknown; however, its sequence has potential transmembrane domains suggesting that it may be an integral membrane protein. Its position between the RH genes suggests that polymorphisms in this gene may be tightly linked to RH haplotypes and may contribute to selective pressure for or against certain RH haplotypes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930488N24Rik T C 17: 14,106,146 noncoding transcript Het
Adamdec1 T C 14: 68,571,766 N249S probably damaging Het
Asxl1 T A 2: 153,399,831 V767E probably benign Het
Atp6v1f T C 6: 29,470,272 probably benign Het
Brix1 T C 15: 10,483,292 probably null Het
Cap2 T C 13: 46,531,025 V2A probably damaging Het
Chrnb2 A G 3: 89,760,941 C356R probably damaging Het
Chtf8 C T 8: 106,885,792 G172R probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dact2 T A 17: 14,196,729 K403M possibly damaging Het
Dhx40 A C 11: 86,771,210 L674V possibly damaging Het
Dlc1 A G 8: 36,577,131 V1230A probably damaging Het
Dnah7b T A 1: 46,290,775 S3260T probably benign Het
Eef1a2 T A 2: 181,148,088 D428V probably benign Het
Ehd1 T C 19: 6,294,243 F178L possibly damaging Het
F2 A T 2: 91,634,971 probably benign Het
Fam186a T C 15: 99,946,842 D507G unknown Het
Fbxo11 G A 17: 88,065,274 probably benign Het
Fry A T 5: 150,495,703 M2871L probably benign Het
Gabrr2 A G 4: 33,095,512 D442G probably damaging Het
Gemin5 A G 11: 58,164,277 I214T probably benign Het
Gfra2 A G 14: 70,967,015 N175S probably damaging Het
Gm8994 T G 6: 136,329,264 V241G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Jhy C T 9: 40,897,525 probably benign Het
Krtap5-5 A T 7: 142,229,419 C165S unknown Het
Lce1k T A 3: 92,806,827 T17S unknown Het
Map3k1 C T 13: 111,772,612 R268Q probably damaging Het
Med13l T A 5: 118,745,130 H1351Q probably damaging Het
Met T C 6: 17,546,996 V876A probably damaging Het
Mical2 T C 7: 112,336,900 S903P probably benign Het
Mkks A G 2: 136,876,174 V396A probably benign Het
Mvk T C 5: 114,455,999 V305A probably benign Het
Myo5a A G 9: 75,174,078 T982A probably benign Het
N4bp1 A G 8: 86,861,683 V209A probably benign Het
Nfkbib G T 7: 28,761,748 S158* probably null Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Ogfr A G 2: 180,593,725 probably benign Het
Olfr224 G A 11: 58,566,625 S240F possibly damaging Het
Olfr281 T C 15: 98,456,915 S202P probably damaging Het
Olfr518 G A 7: 108,881,417 T63I probably benign Het
Pcdhga8 T A 18: 37,815,925 D131E probably damaging Het
Plch1 A G 3: 63,740,843 probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Ppp1r12a T C 10: 108,230,590 V214A probably damaging Het
Prr5l A G 2: 101,797,682 probably benign Het
Prss35 A G 9: 86,756,122 Q315R probably damaging Het
Psg29 G T 7: 17,211,912 *469L probably null Het
Psmd4 A G 3: 95,035,859 V78A probably damaging Het
Rad9a C A 19: 4,201,553 probably benign Het
Rfx7 G T 9: 72,617,291 V588F probably benign Het
Rnase13 A C 14: 51,922,595 I29S probably benign Het
Steap2 T C 5: 5,675,866 N386S possibly damaging Het
Ston1 A G 17: 88,645,252 E719G probably damaging Het
Stx4a A G 7: 127,842,762 probably null Het
Tekt2 A G 4: 126,323,470 S212P possibly damaging Het
Tex19.2 A T 11: 121,116,956 L222Q probably damaging Het
Ubr2 A G 17: 46,985,996 V286A possibly damaging Het
Ugt2b35 T C 5: 87,003,300 M255T possibly damaging Het
Vmn2r17 T A 5: 109,453,354 F839L probably benign Het
Wdr36 T C 18: 32,859,261 V617A possibly damaging Het
Wtip A T 7: 34,119,012 probably null Het
Yeats2 G A 16: 20,207,668 G765S probably benign Het
Zbtb3 T C 19: 8,803,967 S315P probably benign Het
Zdhhc8 T C 16: 18,227,166 M259V probably benign Het
Zfp120 A G 2: 150,119,520 probably benign Het
Zfp236 A T 18: 82,609,418 I1552N possibly damaging Het
Other mutations in Tmem50a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01785:Tmem50a APN 4 134898447 missense probably damaging 1.00
IGL01786:Tmem50a APN 4 134898447 missense probably damaging 1.00
IGL01951:Tmem50a APN 4 134898428 utr 3 prime probably benign
R1502:Tmem50a UTSW 4 134909669 missense probably benign 0.00
R1708:Tmem50a UTSW 4 134898468 missense probably benign 0.19
R1935:Tmem50a UTSW 4 134903642 splice site probably benign
R5625:Tmem50a UTSW 4 134898467 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GAAACTTGCAGTCATCTCCCTG -3'
(R):5'- GCACTGACTGTTCTTCCAGAG -3'

Sequencing Primer
(F):5'- ACAGGTTCCAAGTGTGTCAC -3'
(R):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
Posted On2016-04-15