Incidental Mutation 'R4903:Trip11'
ID377975
Institutional Source Beutler Lab
Gene Symbol Trip11
Ensembl Gene ENSMUSG00000021188
Gene Namethyroid hormone receptor interactor 11
SynonymsGMAP-210, 3110031G15Rik, 2610511G22Rik, 6030460N08Rik, TRIP230
MMRRC Submission 042506-MU
Accession Numbers

Genbank: NM_028446.1; Ensembl: ENSMUST00000021605, ENSMUST00000085086, ENSMUST00000110038

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4903 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location101834043-101913267 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 101886806 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021605] [ENSMUST00000176728] [ENSMUST00000177183] [ENSMUST00000177536]
Predicted Effect probably null
Transcript: ENSMUST00000021605
SMART Domains Protein: ENSMUSP00000021605
Gene: ENSMUSG00000021188

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
coiled coil region 54 130 N/A INTRINSIC
coiled coil region 167 194 N/A INTRINSIC
coiled coil region 218 702 N/A INTRINSIC
coiled coil region 754 990 N/A INTRINSIC
coiled coil region 1022 1051 N/A INTRINSIC
coiled coil region 1196 1261 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
coiled coil region 1336 1481 N/A INTRINSIC
coiled coil region 1547 1657 N/A INTRINSIC
coiled coil region 1681 1771 N/A INTRINSIC
low complexity region 1934 1945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176728
SMART Domains Protein: ENSMUSP00000134992
Gene: ENSMUSG00000021188

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
Pfam:Orthopox_A5L 48 282 6.5e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000177183
SMART Domains Protein: ENSMUSP00000134976
Gene: ENSMUSG00000021188

DomainStartEndE-ValueType
coiled coil region 33 158 N/A INTRINSIC
coiled coil region 179 417 N/A INTRINSIC
coiled coil region 469 705 N/A INTRINSIC
coiled coil region 737 766 N/A INTRINSIC
coiled coil region 911 976 N/A INTRINSIC
low complexity region 1025 1037 N/A INTRINSIC
coiled coil region 1051 1196 N/A INTRINSIC
coiled coil region 1262 1372 N/A INTRINSIC
coiled coil region 1396 1486 N/A INTRINSIC
low complexity region 1649 1660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177480
Predicted Effect probably null
Transcript: ENSMUST00000177536
SMART Domains Protein: ENSMUSP00000135669
Gene: ENSMUSG00000021188

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
coiled coil region 53 129 N/A INTRINSIC
coiled coil region 166 193 N/A INTRINSIC
coiled coil region 217 517 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on the interaction of its protein product with thyroid hormone receptor beta. This protein is associated with the Golgi apparatus. The N-terminal region of the protein binds Golgi membranes and the C-terminal region binds the minus ends of microtubules; thus, the protein is thought to play a role in assembly and maintenance of the Golgi ribbon structure around the centrosome. Mutations in this gene cause achondrogenesis type IA.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with small size, lung hypoplasia, omphalocele, and ventricular septal defects. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Gene trapped(11) Chemically induced(1)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T A 7: 127,385,406 T175S probably benign Het
A430033K04Rik G T 5: 138,646,857 E335* probably null Het
Abca9 A G 11: 110,147,001 Y508H probably damaging Het
Abcc9 A T 6: 142,600,965 L1347H probably damaging Het
Acox3 A G 5: 35,589,736 N166D probably damaging Het
Adam5 T C 8: 24,786,232 Y473C probably damaging Het
Agbl2 A G 2: 90,797,473 I207M possibly damaging Het
Akna C A 4: 63,374,037 R1130S probably damaging Het
Alg12 A T 15: 88,814,540 I194N probably damaging Het
Alk T A 17: 71,869,563 H1582L probably damaging Het
Atn1 G C 6: 124,743,257 probably benign Het
Carhsp1 T C 16: 8,661,000 T130A probably damaging Het
Chrna3 T C 9: 55,015,526 T333A probably benign Het
Ctsr T A 13: 61,163,131 I34L probably benign Het
Cxcl16 A G 11: 70,455,693 V208A probably benign Het
Dars2 G C 1: 161,051,371 P362R probably benign Het
Dnah10 A G 5: 124,817,748 E3459G probably damaging Het
Dus2 G A 8: 106,044,805 D188N probably benign Het
Ece2 C T 16: 20,631,222 R189* probably null Het
Egfr A T 11: 16,908,949 D976V probably damaging Het
Egr2 T A 10: 67,538,333 I51N probably damaging Het
Exoc3l4 A G 12: 111,428,721 H591R probably benign Het
G2e3 A G 12: 51,371,630 I603V probably benign Het
Gm11564 A C 11: 99,815,032 C191G unknown Het
Gpatch8 A G 11: 102,480,133 S860P unknown Het
Gprin1 C G 13: 54,737,929 W844S probably damaging Het
Hhipl2 T A 1: 183,426,790 Y252* probably null Het
Hormad1 T A 3: 95,585,220 probably null Het
Hrg A G 16: 22,961,151 probably benign Het
Hsh2d C T 8: 72,193,528 A23V probably benign Het
Ints6 A G 14: 62,702,462 L593P probably damaging Het
Jak2 A G 19: 29,275,036 S129G probably benign Het
Kif1a C T 1: 93,021,734 E1579K probably damaging Het
Lhcgr A T 17: 88,742,361 I579N probably damaging Het
Lrig3 A T 10: 125,996,613 probably null Het
Man2c1 C A 9: 57,138,956 Q465K probably benign Het
Map3k5 T A 10: 20,118,489 L1043Q probably null Het
Map4k1 A T 7: 28,983,002 H16L probably benign Het
Mapk8ip3 A G 17: 24,901,209 S946P probably benign Het
Mrpl50 T C 4: 49,514,488 Y61C probably damaging Het
Myf5 A T 10: 107,485,872 C20* probably null Het
Nek11 T C 9: 105,314,722 K163R possibly damaging Het
Olfr1202 A T 2: 88,817,998 I276L probably benign Het
Olfr364-ps1 A T 2: 37,146,371 H53L probably benign Het
Pcdhga9 C A 18: 37,739,005 T629K probably damaging Het
Pglyrp1 A G 7: 18,890,203 N137S probably benign Het
Pip5k1a T C 3: 95,070,783 I275V probably benign Het
Pitpnm2 T A 5: 124,152,605 Y6F probably damaging Het
Pkd1 T G 17: 24,572,002 V1057G probably benign Het
Plcb3 C A 19: 6,955,843 R970L probably damaging Het
Plekha5 T A 6: 140,586,367 M586K probably damaging Het
Ppp4r4 T A 12: 103,590,771 probably null Het
Rasal3 C T 17: 32,397,383 C278Y probably damaging Het
Rbm34 T C 8: 126,951,337 D269G possibly damaging Het
Rnf32 G A 5: 29,198,578 R7H probably benign Het
Sema3d A G 5: 12,563,158 K401E probably benign Het
Sema7a T C 9: 57,955,095 Y194H probably benign Het
Senp5 A T 16: 31,983,299 Y585N probably damaging Het
Serpinb9 T A 13: 33,008,864 W135R probably damaging Het
Shbg C T 11: 69,615,086 S365N probably benign Het
Slc39a6 A T 18: 24,597,868 S65T probably damaging Het
Stk3 T C 15: 34,959,066 E320G probably damaging Het
Syk T A 13: 52,611,081 H81Q probably damaging Het
Tet1 A G 10: 62,822,658 W1470R probably damaging Het
Thada C A 17: 84,252,400 V1450L possibly damaging Het
Tmem241 A G 18: 12,104,119 S87P probably damaging Het
Trdv1 T A 14: 53,881,918 probably benign Het
Trim40 T C 17: 36,883,225 E192G possibly damaging Het
Trmt2a T A 16: 18,249,554 C30* probably null Het
Tshr A G 12: 91,401,188 D35G probably benign Het
Tssc4 T C 7: 143,070,585 V210A probably damaging Het
Ttk T A 9: 83,865,148 I680N probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl4a T C 18: 80,207,278 F30L probably damaging Het
Ubac2 G T 14: 121,994,238 C192F probably benign Het
Vmn1r12 A G 6: 57,159,517 T156A possibly damaging Het
Other mutations in Trip11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Trip11 APN 12 101886147 missense probably benign 0.37
IGL00484:Trip11 APN 12 101885311 nonsense probably null
IGL00972:Trip11 APN 12 101894337 missense probably null 1.00
IGL01476:Trip11 APN 12 101898911 missense probably damaging 0.96
IGL01591:Trip11 APN 12 101883345 missense probably damaging 0.98
IGL01667:Trip11 APN 12 101878862 missense probably damaging 1.00
IGL01764:Trip11 APN 12 101884631 missense probably damaging 1.00
IGL01789:Trip11 APN 12 101871831 missense probably benign 0.05
IGL01814:Trip11 APN 12 101884488 missense probably damaging 0.98
IGL01898:Trip11 APN 12 101885676 missense probably benign
IGL01924:Trip11 APN 12 101886884 missense possibly damaging 0.93
IGL02020:Trip11 APN 12 101884313 missense probably damaging 1.00
IGL02475:Trip11 APN 12 101895683 missense probably benign 0.01
IGL02544:Trip11 APN 12 101893521 missense probably damaging 1.00
IGL02678:Trip11 APN 12 101883390 missense probably damaging 0.96
IGL02714:Trip11 APN 12 101884001 missense probably damaging 1.00
IGL02718:Trip11 APN 12 101886025 missense probably benign 0.24
IGL02904:Trip11 APN 12 101886838 missense probably damaging 1.00
IGL03012:Trip11 APN 12 101883936 missense probably damaging 1.00
IGL03191:Trip11 APN 12 101898925 missense probably damaging 1.00
IGL03327:Trip11 APN 12 101883418 missense possibly damaging 0.87
IGL03337:Trip11 APN 12 101885019 missense probably damaging 1.00
NA:Trip11 UTSW 12 101894321 unclassified probably null
R0027:Trip11 UTSW 12 101885169 missense probably benign 0.00
R0028:Trip11 UTSW 12 101884757 missense probably damaging 1.00
R0238:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0238:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0239:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0239:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0505:Trip11 UTSW 12 101885672 missense probably damaging 0.98
R0556:Trip11 UTSW 12 101884518 nonsense probably null
R0573:Trip11 UTSW 12 101886860 missense probably benign 0.02
R0626:Trip11 UTSW 12 101885976 missense possibly damaging 0.54
R1519:Trip11 UTSW 12 101886160 missense probably benign 0.04
R1530:Trip11 UTSW 12 101912767 missense unknown
R1647:Trip11 UTSW 12 101884392 nonsense probably null
R1648:Trip11 UTSW 12 101884392 nonsense probably null
R1856:Trip11 UTSW 12 101883333 nonsense probably null
R2013:Trip11 UTSW 12 101837722 missense probably damaging 1.00
R2017:Trip11 UTSW 12 101885360 missense probably benign 0.00
R2206:Trip11 UTSW 12 101873442 missense probably benign 0.25
R2207:Trip11 UTSW 12 101873442 missense probably benign 0.25
R2304:Trip11 UTSW 12 101898977 missense possibly damaging 0.58
R2328:Trip11 UTSW 12 101878827 makesense probably null
R2513:Trip11 UTSW 12 101837727 missense possibly damaging 0.94
R3499:Trip11 UTSW 12 101893694 missense possibly damaging 0.87
R4105:Trip11 UTSW 12 101894322 nonsense probably null
R4124:Trip11 UTSW 12 101895698 nonsense probably null
R4126:Trip11 UTSW 12 101895698 nonsense probably null
R4128:Trip11 UTSW 12 101895698 nonsense probably null
R4175:Trip11 UTSW 12 101895698 nonsense probably null
R4176:Trip11 UTSW 12 101895698 nonsense probably null
R4181:Trip11 UTSW 12 101893768 missense probably damaging 1.00
R4296:Trip11 UTSW 12 101885868 nonsense probably null
R4302:Trip11 UTSW 12 101893768 missense probably damaging 1.00
R4306:Trip11 UTSW 12 101886939 missense probably benign
R4342:Trip11 UTSW 12 101884316 missense probably damaging 1.00
R4576:Trip11 UTSW 12 101886240 nonsense probably null
R4586:Trip11 UTSW 12 101883341 missense possibly damaging 0.55
R4634:Trip11 UTSW 12 101837616 missense probably damaging 1.00
R4696:Trip11 UTSW 12 101885290 missense possibly damaging 0.71
R4792:Trip11 UTSW 12 101885446 missense probably benign 0.10
R5001:Trip11 UTSW 12 101884910 nonsense probably null
R5017:Trip11 UTSW 12 101846620 missense probably benign 0.00
R5227:Trip11 UTSW 12 101884920 missense probably damaging 1.00
R5231:Trip11 UTSW 12 101885601 missense probably damaging 0.96
R5539:Trip11 UTSW 12 101885127 missense probably damaging 0.98
R5754:Trip11 UTSW 12 101885665 nonsense probably null
R5755:Trip11 UTSW 12 101885665 nonsense probably null
R5890:Trip11 UTSW 12 101885972 missense probably damaging 0.99
R5910:Trip11 UTSW 12 101883479 missense probably damaging 1.00
R6083:Trip11 UTSW 12 101889742 missense probably benign 0.00
R6208:Trip11 UTSW 12 101898895 missense probably damaging 1.00
R6216:Trip11 UTSW 12 101890600 missense probably benign 0.31
R6315:Trip11 UTSW 12 101885578 missense possibly damaging 0.84
R6413:Trip11 UTSW 12 101885531 missense probably benign 0.12
R6590:Trip11 UTSW 12 101885451 missense possibly damaging 0.92
R6690:Trip11 UTSW 12 101885451 missense possibly damaging 0.92
R6914:Trip11 UTSW 12 101846620 missense probably benign 0.00
R6938:Trip11 UTSW 12 101837627 missense probably damaging 0.98
R7015:Trip11 UTSW 12 101893683 missense probably damaging 1.00
R7023:Trip11 UTSW 12 101885867 missense probably benign 0.13
R7133:Trip11 UTSW 12 101884070 missense probably damaging 0.97
R7271:Trip11 UTSW 12 101884352 missense probably damaging 1.00
R7424:Trip11 UTSW 12 101885198 missense probably damaging 1.00
R7431:Trip11 UTSW 12 101884019 missense possibly damaging 0.84
R7472:Trip11 UTSW 12 101885380 missense probably benign 0.00
R7491:Trip11 UTSW 12 101885435 missense probably damaging 1.00
X0020:Trip11 UTSW 12 101885913 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTGTGCTAACTTGTTCACATC -3'
(R):5'- CACTTTCCAAACTGAGCAGTG -3'

Sequencing Primer
(F):5'- TTGTTCACATCCCCCAACTCAGAG -3'
(R):5'- CTTTCCAAACTGAGCAGTGAATATG -3'
Posted On2016-04-15