Incidental Mutation 'R4905:Zscan29'
List |< first << previous [record 1871 of 1871]
ID378084
Institutional Source Beutler Lab
Gene Symbol Zscan29
Ensembl Gene ENSMUSG00000050619
Gene Namezinc finger SCAN domains 29
SynonymsZfp690
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R4905 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location121158273-121171125 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 121161383 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Threonine at position 540 (R540T)
Ref Sequence ENSEMBL: ENSMUSP00000078033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028702] [ENSMUST00000066155] [ENSMUST00000079024] [ENSMUST00000110661] [ENSMUST00000110665] [ENSMUST00000119031] [ENSMUST00000146243] [ENSMUST00000163766]
Predicted Effect probably benign
Transcript: ENSMUST00000028702
SMART Domains Protein: ENSMUSP00000028702
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 1 276 1.8e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066155
SMART Domains Protein: ENSMUSP00000067133
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 16 343 1.6e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000079024
AA Change: R540T

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078033
Gene: ENSMUSG00000050619
AA Change: R540T

DomainStartEndE-ValueType
SCAN 13 125 5.83e-70 SMART
Pfam:Myb_DNA-bind_4 238 323 3e-21 PFAM
Pfam:Myb_DNA-bind_4 399 484 4.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110661
AA Change: K606N

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000106289
Gene: ENSMUSG00000050619
AA Change: K606N

DomainStartEndE-ValueType
SCAN 13 125 5.83e-70 SMART
Pfam:Myb_DNA-bind_4 238 323 5.4e-21 PFAM
Pfam:Myb_DNA-bind_4 399 484 7.4e-22 PFAM
low complexity region 518 532 N/A INTRINSIC
ZnF_C2H2 665 687 2.99e-4 SMART
ZnF_C2H2 693 715 2.75e-3 SMART
ZnF_C2H2 721 743 8.02e-5 SMART
ZnF_C2H2 749 771 1.13e-4 SMART
ZnF_C2H2 777 799 1.18e-2 SMART
ZnF_C2H2 805 827 1.33e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110665
SMART Domains Protein: ENSMUSP00000106293
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 2 236 4.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119031
SMART Domains Protein: ENSMUSP00000113052
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 16 343 3e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146243
SMART Domains Protein: ENSMUSP00000120997
Gene: ENSMUSG00000050619

DomainStartEndE-ValueType
SCAN 13 118 4.23e-58 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156370
Predicted Effect probably benign
Transcript: ENSMUST00000163766
AA Change: K641N

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000125987
Gene: ENSMUSG00000050619
AA Change: K641N

DomainStartEndE-ValueType
SCAN 13 125 5.83e-70 SMART
Pfam:Myb_DNA-bind_4 238 323 5.9e-21 PFAM
Pfam:Myb_DNA-bind_4 434 519 1.3e-21 PFAM
low complexity region 553 567 N/A INTRINSIC
ZnF_C2H2 700 722 2.99e-4 SMART
ZnF_C2H2 728 750 2.75e-3 SMART
ZnF_C2H2 756 778 8.02e-5 SMART
ZnF_C2H2 784 806 1.13e-4 SMART
ZnF_C2H2 812 834 1.18e-2 SMART
ZnF_C2H2 840 862 1.33e-1 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,612,818 probably null Het
1700123L14Rik T A 6: 96,165,930 R44S possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
9530053A07Rik A T 7: 28,156,983 K2065M possibly damaging Het
Abcc5 A G 16: 20,399,928 S235P probably damaging Het
Abcc6 T C 7: 45,995,225 N842S probably benign Het
Acbd6 G A 1: 155,624,923 V210I probably benign Het
Ahctf1 A T 1: 179,748,627 V2130D probably damaging Het
Akap5 A G 12: 76,328,433 E213G probably damaging Het
Alyref T G 11: 120,596,053 probably null Het
Anapc5 G T 5: 122,817,910 N152K probably benign Het
Atp8b2 A T 3: 89,949,008 D416E probably benign Het
AW551984 A T 9: 39,597,158 V354E probably damaging Het
Bag6 A G 17: 35,145,186 E844G probably damaging Het
Bmp1 C T 14: 70,491,362 R590H probably benign Het
Ccnh T C 13: 85,206,135 S233P possibly damaging Het
Cdca7 TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA 2: 72,481,861 probably benign Het
Col6a6 A G 9: 105,767,424 S1222P probably damaging Het
Dhfr G A 13: 92,365,774 G118S probably damaging Het
Dnah9 G A 11: 65,874,124 R1414* probably null Het
Dnaic1 A G 4: 41,614,269 D315G probably benign Het
Eogt T C 6: 97,142,831 R139G probably benign Het
Fh1 C T 1: 175,619,073 G79E probably damaging Het
Gabrg3 A G 7: 56,724,556 Y421H probably damaging Het
Glipr1 C A 10: 111,985,640 R219L probably damaging Het
Gm1123 T C 9: 99,009,316 D360G probably benign Het
Ift81 C T 5: 122,591,079 probably null Het
Itsn2 A G 12: 4,634,583 probably benign Het
Kri1 A T 9: 21,287,702 H55Q probably benign Het
Mcidas C A 13: 112,994,417 A92E possibly damaging Het
Mcidas C T 13: 112,997,504 T174M possibly damaging Het
Mmp25 C A 17: 23,644,048 G130* probably null Het
Myh11 G A 16: 14,250,523 T211M probably benign Het
Myo10 A G 15: 25,800,212 D1458G probably damaging Het
Ncf4 A G 15: 78,254,904 T154A probably damaging Het
Nfatc4 T C 14: 55,830,582 I620T probably benign Het
Nos3 A T 5: 24,367,331 Y134F probably benign Het
Olfr1459 C A 19: 13,146,177 A161S probably benign Het
Olfr273 T C 4: 52,855,613 N300S probably damaging Het
Olfr575 A T 7: 102,955,514 I36N probably damaging Het
Olfr799 T A 10: 129,647,923 V265E possibly damaging Het
Pax9 G T 12: 56,696,626 R19S probably damaging Het
Pcdha9 T C 18: 36,998,892 I338T probably damaging Het
Plxnb2 G T 15: 89,157,411 T1730K probably damaging Het
Rac1 A G 5: 143,517,152 probably null Het
Samsn1 G T 16: 75,876,465 F174L possibly damaging Het
Scaf1 G A 7: 45,012,705 T86M probably damaging Het
Smc1b A G 15: 85,066,227 Y1199H probably damaging Het
Svep1 A G 4: 58,069,308 I2826T probably benign Het
Tex36 A G 7: 133,587,453 V130A probably damaging Het
Tigd5 A G 15: 75,911,403 H538R probably damaging Het
Tlr3 C A 8: 45,399,223 probably null Het
Tubb2b A T 13: 34,128,204 I202N probably damaging Het
Unc13c A G 9: 73,680,392 V1453A probably benign Het
Unc5c A T 3: 141,801,310 T608S probably benign Het
Vrk1 C A 12: 106,051,828 H119N probably damaging Het
Wdr53 T A 16: 32,256,658 M227K probably benign Het
Xpo4 T C 14: 57,638,289 D129G possibly damaging Het
Zcchc4 T C 5: 52,796,650 I224T probably damaging Het
Zdhhc1 T A 8: 105,483,694 E30D probably damaging Het
Other mutations in Zscan29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Zscan29 APN 2 121170057 missense probably damaging 1.00
IGL01938:Zscan29 APN 2 121166209 missense probably benign 0.16
IGL02220:Zscan29 APN 2 121166689 missense probably damaging 0.99
IGL02370:Zscan29 APN 2 121163833 missense probably benign 0.00
IGL02585:Zscan29 APN 2 121163876 nonsense probably null
R0284:Zscan29 UTSW 2 121166733 unclassified probably benign
R0842:Zscan29 UTSW 2 121161479 missense possibly damaging 0.84
R1245:Zscan29 UTSW 2 121166503 missense probably damaging 1.00
R1586:Zscan29 UTSW 2 121161160 missense probably damaging 1.00
R1654:Zscan29 UTSW 2 121164779 missense probably benign 0.06
R1958:Zscan29 UTSW 2 121169808 critical splice donor site probably null
R2073:Zscan29 UTSW 2 121160855 nonsense probably null
R2085:Zscan29 UTSW 2 121169946 nonsense probably null
R2145:Zscan29 UTSW 2 121170106 missense probably damaging 1.00
R2201:Zscan29 UTSW 2 121169402 missense probably damaging 1.00
R2875:Zscan29 UTSW 2 121164100 missense probably damaging 1.00
R2876:Zscan29 UTSW 2 121164100 missense probably damaging 1.00
R3861:Zscan29 UTSW 2 121160731 missense probably benign 0.01
R4244:Zscan29 UTSW 2 121164794 unclassified probably null
R4245:Zscan29 UTSW 2 121164794 unclassified probably null
R4447:Zscan29 UTSW 2 121169886 unclassified probably null
R4662:Zscan29 UTSW 2 121166615 missense probably benign 0.26
R4757:Zscan29 UTSW 2 121160911 missense possibly damaging 0.92
R4777:Zscan29 UTSW 2 121169324 missense probably damaging 0.96
R4970:Zscan29 UTSW 2 121169195 splice site probably null
R5860:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R5861:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R5862:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R5916:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R5917:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R5918:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R6335:Zscan29 UTSW 2 121161436 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TGAGCTCTGGTTGAAGCG -3'
(R):5'- GGTACATTTGTTAGGGAAATGAATAAC -3'

Sequencing Primer
(F):5'- TGGAACTGTCACGGAAACCTTTC -3'
(R):5'- GTGTTCTTGTATTAGGTTTCGAGGC -3'
Posted On2016-04-15