Incidental Mutation 'R4917:Cacna1s'
ID378254
Institutional Source Beutler Lab
Gene Symbol Cacna1s
Ensembl Gene ENSMUSG00000026407
Gene Namecalcium channel, voltage-dependent, L type, alpha 1S subunit
Synonymssj, mdg, muscle dysgenesis, DHPR alpha1s, Cav1.1, Cchl1a3, fmd
MMRRC Submission 042519-MU
Accession Numbers

Genbank: NM_001081023; MGI: 88294

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4917 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location136052750-136119822 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 136101564 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112064] [ENSMUST00000112068] [ENSMUST00000160641] [ENSMUST00000161865]
Predicted Effect probably null
Transcript: ENSMUST00000112064
SMART Domains Protein: ENSMUSP00000107695
Gene: ENSMUSG00000026407

DomainStartEndE-ValueType
Pfam:Ion_trans 50 345 4.3e-68 PFAM
Pfam:Ion_trans 431 672 4.5e-56 PFAM
Pfam:PKD_channel 516 667 1.9e-7 PFAM
low complexity region 675 685 N/A INTRINSIC
low complexity region 740 756 N/A INTRINSIC
Pfam:Ion_trans 798 1076 2.6e-65 PFAM
Pfam:Ion_trans 1117 1392 1.2e-71 PFAM
Pfam:PKD_channel 1126 1387 8.4e-13 PFAM
Pfam:GPHH 1394 1463 2.3e-38 PFAM
Ca_chan_IQ 1515 1548 3.71e-14 SMART
low complexity region 1657 1669 N/A INTRINSIC
Pfam:CAC1F_C 1756 1845 2.8e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000112068
SMART Domains Protein: ENSMUSP00000107699
Gene: ENSMUSG00000026407

DomainStartEndE-ValueType
Pfam:Ion_trans 88 333 9.1e-57 PFAM
PDB:4DEY|B 334 417 1e-20 PDB
Pfam:Ion_trans 466 660 3.7e-46 PFAM
Pfam:PKD_channel 513 667 6.7e-7 PFAM
low complexity region 675 685 N/A INTRINSIC
low complexity region 740 756 N/A INTRINSIC
low complexity region 804 818 N/A INTRINSIC
Pfam:Ion_trans 834 1064 3.9e-53 PFAM
Pfam:Ion_trans 1152 1361 6.7e-66 PFAM
Pfam:PKD_channel 1201 1368 8.4e-10 PFAM
Blast:EFh 1382 1410 5e-8 BLAST
Ca_chan_IQ 1496 1529 3.71e-14 SMART
low complexity region 1638 1650 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000160641
SMART Domains Protein: ENSMUSP00000125278
Gene: ENSMUSG00000026407

DomainStartEndE-ValueType
Pfam:Ion_trans 88 333 9.3e-57 PFAM
PDB:4DEY|B 334 417 1e-20 PDB
Pfam:Ion_trans 466 660 3.8e-46 PFAM
Pfam:PKD_channel 513 667 6.7e-7 PFAM
low complexity region 675 685 N/A INTRINSIC
low complexity region 740 756 N/A INTRINSIC
low complexity region 804 818 N/A INTRINSIC
Pfam:Ion_trans 834 1064 4e-53 PFAM
Pfam:PKD_channel 1126 1387 6.1e-12 PFAM
Pfam:Ion_trans 1152 1380 9e-65 PFAM
Blast:EFh 1401 1429 5e-8 BLAST
Ca_chan_IQ 1515 1548 3.71e-14 SMART
low complexity region 1657 1669 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161700
Predicted Effect probably null
Transcript: ENSMUST00000161865
SMART Domains Protein: ENSMUSP00000125262
Gene: ENSMUSG00000026407

DomainStartEndE-ValueType
Pfam:Ion_trans 3 98 1.1e-21 PFAM
Pfam:Ion_trans 184 425 3.3e-56 PFAM
Pfam:PKD_channel 267 420 1.8e-7 PFAM
low complexity region 428 438 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
Pfam:Ion_trans 551 829 1.9e-65 PFAM
Pfam:Ion_trans 870 1126 5.4e-72 PFAM
Pfam:PKD_channel 954 1121 7.2e-10 PFAM
Pfam:GPHH 1128 1197 1.8e-38 PFAM
Ca_chan_IQ 1249 1282 3.71e-14 SMART
low complexity region 1391 1403 N/A INTRINSIC
Meta Mutation Damage Score 0.644 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 97% (111/114)
MGI Phenotype Strain: 1856326
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the five subunits of the slowly inactivating L-type voltage-dependent calcium channel in skeletal muscle cells. Mutations in this gene have been associated with hypokalemic periodic paralysis, thyrotoxic periodic paralysis and malignant hyperthermia susceptibility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show edema and failure of myoblast differentiation by day 13 of embryonic development and die perinatally. All muscles degenerate and additional secondary anomalies of the skeleton, short jaw, and cleft palate are seen. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Spontaneous(1)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A C 9: 103,251,855 Y235* probably null Het
Adgrv1 C T 13: 81,510,877 V2783I probably benign Het
Ago4 A C 4: 126,506,842 C693G probably damaging Het
Apobec2 T C 17: 48,423,125 E171G probably benign Het
Arfgef3 T A 10: 18,616,890 I1258F probably damaging Het
Arhgef40 A G 14: 51,990,099 E434G probably damaging Het
Bcas1 T C 2: 170,378,886 D324G probably damaging Het
Bdp1 A T 13: 100,055,205 V1422E probably damaging Het
Bfsp1 C T 2: 143,827,471 R396Q probably benign Het
Bpifb9b T A 2: 154,314,106 probably null Het
Casp8 T C 1: 58,827,218 F126S probably damaging Het
Cdh26 T C 2: 178,449,821 S58P probably benign Het
Cds2 A G 2: 132,298,478 T182A probably damaging Het
Cfap157 C T 2: 32,779,953 R206H probably benign Het
Col7a1 G A 9: 108,966,464 G1529E unknown Het
Crybg3 A G 16: 59,530,419 F2567L probably benign Het
Cyp2e1 T C 7: 140,774,614 S393P possibly damaging Het
D5Ertd579e A G 5: 36,615,816 Y412H probably damaging Het
Dclk2 A T 3: 86,824,742 probably null Het
Ddx50 A T 10: 62,627,671 C414* probably null Het
Dip2c T A 13: 9,621,869 probably null Het
Dmtn G T 14: 70,605,719 P283Q probably damaging Het
Dspp C A 5: 104,177,923 D717E unknown Het
Efcab11 T C 12: 99,719,062 D151G probably damaging Het
Egfem1 T C 3: 29,151,893 V93A probably damaging Het
Ehbp1 T C 11: 22,146,592 D299G probably benign Het
Erlec1 A G 11: 30,934,710 Y448H possibly damaging Het
Fer1l4 T C 2: 156,031,300 K1287E probably benign Het
Fn1 A T 1: 71,595,809 probably null Het
Fut8 G T 12: 77,475,044 A486S probably damaging Het
Gfra1 A T 19: 58,267,090 S308R probably damaging Het
Gm10764 A G 10: 87,290,717 noncoding transcript Het
Gm5958 C A 14: 99,835,753 noncoding transcript Het
Gm6788 C T 19: 28,763,264 noncoding transcript Het
Gsdmd A G 15: 75,864,392 I123M probably benign Het
Hist1h2bl A T 13: 21,716,019 V42E probably damaging Het
Hsf4 A G 8: 105,272,735 E235G probably benign Het
Ighv1-83 T C 12: 115,963,960 I57V probably benign Het
Inpp5f A T 7: 128,685,116 D573V probably damaging Het
Kcnj1 T A 9: 32,396,760 L160Q probably damaging Het
Kcnmb3 A T 3: 32,472,504 C179* probably null Het
Lrig1 A G 6: 94,609,719 F659L probably damaging Het
Lrrc3 T C 10: 77,901,419 D61G probably benign Het
March4 T G 1: 72,428,779 S365R probably benign Het
Mccc1 A G 3: 35,997,554 L32S probably benign Het
Mei4 A G 9: 81,890,163 T10A probably benign Het
Meis1 T C 11: 19,009,222 probably benign Het
Mllt1 T C 17: 56,899,813 T344A probably benign Het
Mmp11 C T 10: 75,925,585 A31T probably damaging Het
Mrps28 A G 3: 8,882,554 probably benign Het
Mthfsl A C 9: 88,715,497 L67V probably damaging Het
Ncaph2 A G 15: 89,360,371 I11V probably damaging Het
Ncdn G A 4: 126,749,938 L364F possibly damaging Het
Nfat5 T A 8: 107,324,652 D47E probably damaging Het
Olfr1350 C T 7: 6,570,644 L218F possibly damaging Het
Olfr1459 T A 19: 13,145,991 I223L possibly damaging Het
Olfr577 A T 7: 102,973,407 I195N possibly damaging Het
Pcdhb3 A T 18: 37,302,399 I473F probably damaging Het
Pcdhgb8 A T 18: 37,764,138 N754Y probably damaging Het
Pgbd5 C A 8: 124,370,566 K408N probably benign Het
Pnisr A G 4: 21,859,330 probably benign Het
Poldip3 A T 15: 83,132,575 probably null Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Psmc3 A G 2: 91,065,972 probably benign Het
Rab3gap1 T A 1: 127,889,177 W58R possibly damaging Het
Rere T A 4: 150,619,144 W1528R probably damaging Het
Rhot1 A G 11: 80,209,201 probably benign Het
Rsf1 T C 7: 97,662,405 S781P probably damaging Het
Rtraf T C 14: 19,823,716 K5R probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 A G 13: 11,594,986 V753A probably damaging Het
Ryr3 T C 2: 112,831,185 H1820R probably damaging Het
Schip1 A T 3: 68,408,485 probably benign Het
Scin T A 12: 40,069,374 I552F possibly damaging Het
Selp A C 1: 164,144,906 T705P probably damaging Het
Sh3rf3 A T 10: 59,007,103 D297V probably damaging Het
Slc24a4 T A 12: 102,264,944 probably null Het
Slc2a9 C A 5: 38,417,260 L224F probably benign Het
Slc35e2 C A 4: 155,616,236 P272Q probably damaging Het
Slf2 T G 19: 44,971,661 D1022E probably damaging Het
Syne1 C T 10: 5,057,909 C7932Y probably damaging Het
Tc2n A G 12: 101,665,695 L301P probably damaging Het
Tchhl1 A G 3: 93,470,316 D109G possibly damaging Het
Thoc7 T C 14: 13,953,154 I83V probably damaging Het
Tm4sf1 C T 3: 57,293,027 G85S probably damaging Het
Tmem63a T A 1: 180,966,521 I541N probably benign Het
Tmpo A G 10: 91,149,549 V357A probably damaging Het
Unc80 T C 1: 66,646,550 Y2278H possibly damaging Het
Vmn1r26 A G 6: 58,008,823 F127S probably damaging Het
Vmn2r8 A T 5: 108,797,398 M781K probably damaging Het
Vps36 T G 8: 22,218,264 M348R possibly damaging Het
Vps45 T C 3: 96,019,631 T535A probably damaging Het
Other mutations in Cacna1s
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Cacna1s APN 1 136084273 nonsense probably null
IGL00517:Cacna1s APN 1 136087339 missense probably damaging 1.00
IGL01316:Cacna1s APN 1 136118964 missense probably benign 0.01
IGL01348:Cacna1s APN 1 136075152 missense possibly damaging 0.95
IGL01739:Cacna1s APN 1 136097132 critical splice donor site probably null
IGL01773:Cacna1s APN 1 136118753 missense probably benign 0.32
IGL02056:Cacna1s APN 1 136119000 missense probably benign
IGL02262:Cacna1s APN 1 136108129 missense probably damaging 0.98
IGL02324:Cacna1s APN 1 136075176 splice site probably benign
IGL02352:Cacna1s APN 1 136093252 splice site probably benign
IGL02359:Cacna1s APN 1 136093252 splice site probably benign
IGL02370:Cacna1s APN 1 136085347 missense probably damaging 1.00
IGL02377:Cacna1s APN 1 136068994 missense probably damaging 1.00
IGL02474:Cacna1s APN 1 136118380 missense probably benign
IGL02606:Cacna1s APN 1 136079519 missense probably damaging 0.99
IGL02833:Cacna1s APN 1 136071005 missense probably benign 0.03
IGL02974:Cacna1s APN 1 136092617 missense possibly damaging 0.78
IGL03064:Cacna1s APN 1 136111993 missense probably damaging 1.00
IGL03093:Cacna1s APN 1 136116064 missense probably benign 0.00
IGL03286:Cacna1s APN 1 136077659 missense probably benign
N/A:Cacna1s UTSW 1 136073509 missense probably benign 0.00
R0030:Cacna1s UTSW 1 136094989 critical splice donor site probably null
R0030:Cacna1s UTSW 1 136094989 critical splice donor site probably null
R0097:Cacna1s UTSW 1 136100622 missense possibly damaging 0.79
R0097:Cacna1s UTSW 1 136100622 missense possibly damaging 0.79
R0240:Cacna1s UTSW 1 136073496 unclassified probably benign
R0255:Cacna1s UTSW 1 136118806 missense possibly damaging 0.93
R0302:Cacna1s UTSW 1 136100604 missense probably benign 0.01
R0319:Cacna1s UTSW 1 136070717 missense probably damaging 0.99
R0411:Cacna1s UTSW 1 136113303 missense probably damaging 1.00
R0413:Cacna1s UTSW 1 136098209 missense probably benign 0.00
R0482:Cacna1s UTSW 1 136113394 missense probably benign
R0491:Cacna1s UTSW 1 136089008 splice site probably benign
R0518:Cacna1s UTSW 1 136076859 missense probably benign
R0717:Cacna1s UTSW 1 136098291 missense probably damaging 1.00
R0725:Cacna1s UTSW 1 136098526 splice site probably benign
R0815:Cacna1s UTSW 1 136112957 missense possibly damaging 0.95
R1384:Cacna1s UTSW 1 136094971 missense probably benign 0.02
R1518:Cacna1s UTSW 1 136098551 missense probably damaging 1.00
R1548:Cacna1s UTSW 1 136110937 missense probably damaging 1.00
R1725:Cacna1s UTSW 1 136098623 missense probably damaging 1.00
R1728:Cacna1s UTSW 1 136118716 missense probably benign
R1729:Cacna1s UTSW 1 136118716 missense probably benign
R1730:Cacna1s UTSW 1 136118716 missense probably benign
R1739:Cacna1s UTSW 1 136118716 missense probably benign
R1762:Cacna1s UTSW 1 136118716 missense probably benign
R1783:Cacna1s UTSW 1 136118716 missense probably benign
R1784:Cacna1s UTSW 1 136118716 missense probably benign
R1785:Cacna1s UTSW 1 136118716 missense probably benign
R1800:Cacna1s UTSW 1 136076854 missense probably benign
R1924:Cacna1s UTSW 1 136089017 splice site probably null
R1969:Cacna1s UTSW 1 136119095 missense probably benign 0.42
R2072:Cacna1s UTSW 1 136079504 missense probably benign
R2380:Cacna1s UTSW 1 136095848 missense probably damaging 1.00
R3110:Cacna1s UTSW 1 136075093 nonsense probably null
R3112:Cacna1s UTSW 1 136075093 nonsense probably null
R3151:Cacna1s UTSW 1 136105794 missense probably damaging 1.00
R3696:Cacna1s UTSW 1 136105814 missense probably damaging 1.00
R3722:Cacna1s UTSW 1 136069042 missense possibly damaging 0.77
R3804:Cacna1s UTSW 1 136107018 missense possibly damaging 0.85
R3813:Cacna1s UTSW 1 136085347 missense probably damaging 1.00
R3905:Cacna1s UTSW 1 136084269 missense probably damaging 0.99
R3907:Cacna1s UTSW 1 136084269 missense probably damaging 0.99
R3909:Cacna1s UTSW 1 136084269 missense probably damaging 0.99
R4170:Cacna1s UTSW 1 136108195 missense probably damaging 1.00
R4329:Cacna1s UTSW 1 136119033 missense probably benign 0.00
R4485:Cacna1s UTSW 1 136076852 missense probably damaging 1.00
R4581:Cacna1s UTSW 1 136070970 unclassified probably null
R4719:Cacna1s UTSW 1 136118652 splice site probably benign
R4816:Cacna1s UTSW 1 136115269 missense possibly damaging 0.89
R4909:Cacna1s UTSW 1 136079604 missense probably damaging 0.99
R5296:Cacna1s UTSW 1 136095785 missense probably benign 0.11
R5411:Cacna1s UTSW 1 136105811 missense probably benign 0.09
R5503:Cacna1s UTSW 1 136086742 missense probably damaging 1.00
R5533:Cacna1s UTSW 1 136098375 critical splice donor site probably null
R5714:Cacna1s UTSW 1 136112066 missense probably benign 0.44
R5775:Cacna1s UTSW 1 136108122 missense probably damaging 1.00
R5814:Cacna1s UTSW 1 136107142 missense probably benign 0.31
R5820:Cacna1s UTSW 1 136079604 missense probably damaging 1.00
R5822:Cacna1s UTSW 1 136112078 missense probably damaging 1.00
R5877:Cacna1s UTSW 1 136100667 missense probably damaging 0.99
R5923:Cacna1s UTSW 1 136076822 missense possibly damaging 0.79
R6021:Cacna1s UTSW 1 136106487 missense probably benign 0.15
R6037:Cacna1s UTSW 1 136070967 missense possibly damaging 0.90
R6037:Cacna1s UTSW 1 136070967 missense possibly damaging 0.90
R6056:Cacna1s UTSW 1 136105836 missense probably damaging 1.00
R6143:Cacna1s UTSW 1 136076758 missense probably damaging 0.99
R6222:Cacna1s UTSW 1 136104622 missense probably benign 0.00
R6237:Cacna1s UTSW 1 136105844 missense possibly damaging 0.88
R6274:Cacna1s UTSW 1 136089045 missense probably benign 0.02
R6609:Cacna1s UTSW 1 136113391 missense probably benign 0.30
R6626:Cacna1s UTSW 1 136094965 missense probably damaging 1.00
R6838:Cacna1s UTSW 1 136084437 missense possibly damaging 0.91
R6848:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6849:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6850:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6851:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6868:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6879:Cacna1s UTSW 1 136115959 missense probably benign 0.12
R6893:Cacna1s UTSW 1 136077693 missense probably benign 0.05
R7017:Cacna1s UTSW 1 136095858 missense probably damaging 0.99
R7228:Cacna1s UTSW 1 136071059 missense possibly damaging 0.90
R7283:Cacna1s UTSW 1 136073708 missense probably damaging 1.00
X0025:Cacna1s UTSW 1 136115970 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGCCCAGGAGCTTGATAAGT -3'
(R):5'- AGACTTGCTGCCCTCTTCAA -3'

Sequencing Primer
(F):5'- GGAGCTTGATAAGTACCCCATC -3'
(R):5'- GTGGGCACACTCATATCAGTCTG -3'
Posted On2016-04-15