Incidental Mutation 'R4917:Cyp2e1'
ID378293
Institutional Source Beutler Lab
Gene Symbol Cyp2e1
Ensembl Gene ENSMUSG00000025479
Gene Namecytochrome P450, family 2, subfamily e, polypeptide 1
SynonymsCyp2e
MMRRC Submission 042519-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4917 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140763739-140774987 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140774614 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 393 (S393P)
Ref Sequence ENSEMBL: ENSMUSP00000148090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026552] [ENSMUST00000026553] [ENSMUST00000209253] [ENSMUST00000210235]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026552
AA Change: S452P

PolyPhen 2 Score 0.614 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000026552
Gene: ENSMUSG00000025479
AA Change: S452P

DomainStartEndE-ValueType
transmembrane domain 2 23 N/A INTRINSIC
Pfam:p450 33 489 1.4e-147 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026553
SMART Domains Protein: ENSMUSP00000026553
Gene: ENSMUSG00000025480

DomainStartEndE-ValueType
Pfam:SYCE1 49 200 5.5e-66 PFAM
coiled coil region 237 294 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209253
AA Change: S393P

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect unknown
Transcript: ENSMUST00000210235
AA Change: S292P
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 97% (111/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is induced by ethanol, the diabetic state, and starvation. The enzyme metabolizes both endogenous substrates, such as ethanol, acetone, and acetal, as well as exogenous substrates including benzene, carbon tetrachloride, ethylene glycol, and nitrosamines which are premutagens found in cigarette smoke. Due to its many substrates, this enzyme may be involved in such varied processes as gluconeogenesis, hepatic cirrhosis, diabetes, and cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit altered responses to xenobiotics including decreased urethane-induced tumors and allylnitrile- or acetamenophen-associated mortality but increased allylnitrile-induced vestibular function loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A C 9: 103,251,855 Y235* probably null Het
Adgrv1 C T 13: 81,510,877 V2783I probably benign Het
Ago4 A C 4: 126,506,842 C693G probably damaging Het
Apobec2 T C 17: 48,423,125 E171G probably benign Het
Arfgef3 T A 10: 18,616,890 I1258F probably damaging Het
Arhgef40 A G 14: 51,990,099 E434G probably damaging Het
Bcas1 T C 2: 170,378,886 D324G probably damaging Het
Bdp1 A T 13: 100,055,205 V1422E probably damaging Het
Bfsp1 C T 2: 143,827,471 R396Q probably benign Het
Bpifb9b T A 2: 154,314,106 probably null Het
Cacna1s T A 1: 136,101,564 probably null Het
Casp8 T C 1: 58,827,218 F126S probably damaging Het
Cdh26 T C 2: 178,449,821 S58P probably benign Het
Cds2 A G 2: 132,298,478 T182A probably damaging Het
Cfap157 C T 2: 32,779,953 R206H probably benign Het
Col7a1 G A 9: 108,966,464 G1529E unknown Het
Crybg3 A G 16: 59,530,419 F2567L probably benign Het
D5Ertd579e A G 5: 36,615,816 Y412H probably damaging Het
Dclk2 A T 3: 86,824,742 probably null Het
Ddx50 A T 10: 62,627,671 C414* probably null Het
Dip2c T A 13: 9,621,869 probably null Het
Dmtn G T 14: 70,605,719 P283Q probably damaging Het
Dspp C A 5: 104,177,923 D717E unknown Het
Efcab11 T C 12: 99,719,062 D151G probably damaging Het
Egfem1 T C 3: 29,151,893 V93A probably damaging Het
Ehbp1 T C 11: 22,146,592 D299G probably benign Het
Erlec1 A G 11: 30,934,710 Y448H possibly damaging Het
Fer1l4 T C 2: 156,031,300 K1287E probably benign Het
Fn1 A T 1: 71,595,809 probably null Het
Fut8 G T 12: 77,475,044 A486S probably damaging Het
Gfra1 A T 19: 58,267,090 S308R probably damaging Het
Gm10764 A G 10: 87,290,717 noncoding transcript Het
Gm5958 C A 14: 99,835,753 noncoding transcript Het
Gm6788 C T 19: 28,763,264 noncoding transcript Het
Gsdmd A G 15: 75,864,392 I123M probably benign Het
Hist1h2bl A T 13: 21,716,019 V42E probably damaging Het
Hsf4 A G 8: 105,272,735 E235G probably benign Het
Ighv1-83 T C 12: 115,963,960 I57V probably benign Het
Inpp5f A T 7: 128,685,116 D573V probably damaging Het
Kcnj1 T A 9: 32,396,760 L160Q probably damaging Het
Kcnmb3 A T 3: 32,472,504 C179* probably null Het
Lrig1 A G 6: 94,609,719 F659L probably damaging Het
Lrrc3 T C 10: 77,901,419 D61G probably benign Het
March4 T G 1: 72,428,779 S365R probably benign Het
Mccc1 A G 3: 35,997,554 L32S probably benign Het
Mei4 A G 9: 81,890,163 T10A probably benign Het
Meis1 T C 11: 19,009,222 probably benign Het
Mllt1 T C 17: 56,899,813 T344A probably benign Het
Mmp11 C T 10: 75,925,585 A31T probably damaging Het
Mrps28 A G 3: 8,882,554 probably benign Het
Mthfsl A C 9: 88,715,497 L67V probably damaging Het
Ncaph2 A G 15: 89,360,371 I11V probably damaging Het
Ncdn G A 4: 126,749,938 L364F possibly damaging Het
Nfat5 T A 8: 107,324,652 D47E probably damaging Het
Olfr1350 C T 7: 6,570,644 L218F possibly damaging Het
Olfr1459 T A 19: 13,145,991 I223L possibly damaging Het
Olfr577 A T 7: 102,973,407 I195N possibly damaging Het
Pcdhb3 A T 18: 37,302,399 I473F probably damaging Het
Pcdhgb8 A T 18: 37,764,138 N754Y probably damaging Het
Pgbd5 C A 8: 124,370,566 K408N probably benign Het
Pnisr A G 4: 21,859,330 probably benign Het
Poldip3 A T 15: 83,132,575 probably null Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Psmc3 A G 2: 91,065,972 probably benign Het
Rab3gap1 T A 1: 127,889,177 W58R possibly damaging Het
Rere T A 4: 150,619,144 W1528R probably damaging Het
Rhot1 A G 11: 80,209,201 probably benign Het
Rsf1 T C 7: 97,662,405 S781P probably damaging Het
Rtraf T C 14: 19,823,716 K5R probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 A G 13: 11,594,986 V753A probably damaging Het
Ryr3 T C 2: 112,831,185 H1820R probably damaging Het
Schip1 A T 3: 68,408,485 probably benign Het
Scin T A 12: 40,069,374 I552F possibly damaging Het
Selp A C 1: 164,144,906 T705P probably damaging Het
Sh3rf3 A T 10: 59,007,103 D297V probably damaging Het
Slc24a4 T A 12: 102,264,944 probably null Het
Slc2a9 C A 5: 38,417,260 L224F probably benign Het
Slc35e2 C A 4: 155,616,236 P272Q probably damaging Het
Slf2 T G 19: 44,971,661 D1022E probably damaging Het
Syne1 C T 10: 5,057,909 C7932Y probably damaging Het
Tc2n A G 12: 101,665,695 L301P probably damaging Het
Tchhl1 A G 3: 93,470,316 D109G possibly damaging Het
Thoc7 T C 14: 13,953,154 I83V probably damaging Het
Tm4sf1 C T 3: 57,293,027 G85S probably damaging Het
Tmem63a T A 1: 180,966,521 I541N probably benign Het
Tmpo A G 10: 91,149,549 V357A probably damaging Het
Unc80 T C 1: 66,646,550 Y2278H possibly damaging Het
Vmn1r26 A G 6: 58,008,823 F127S probably damaging Het
Vmn2r8 A T 5: 108,797,398 M781K probably damaging Het
Vps36 T G 8: 22,218,264 M348R possibly damaging Het
Vps45 T C 3: 96,019,631 T535A probably damaging Het
Other mutations in Cyp2e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Cyp2e1 APN 7 140769153 missense probably benign 0.17
IGL01755:Cyp2e1 APN 7 140774556 critical splice acceptor site probably null
IGL01884:Cyp2e1 APN 7 140773750 missense probably benign 0.16
IGL01950:Cyp2e1 APN 7 140764961 critical splice donor site probably null
IGL01964:Cyp2e1 APN 7 140763866 missense probably damaging 1.00
IGL02430:Cyp2e1 APN 7 140770226 missense probably damaging 1.00
IGL02505:Cyp2e1 APN 7 140769156 missense probably damaging 1.00
IGL02596:Cyp2e1 APN 7 140770118 missense probably damaging 0.99
IGL02725:Cyp2e1 APN 7 140763915 missense probably null 1.00
IGL02887:Cyp2e1 APN 7 140763911 missense probably damaging 1.00
IGL03114:Cyp2e1 APN 7 140773129 missense possibly damaging 0.95
IGL03146:Cyp2e1 APN 7 140770221 missense probably benign 0.00
IGL03340:Cyp2e1 APN 7 140764854 missense probably damaging 1.00
R1396:Cyp2e1 UTSW 7 140773079 missense probably damaging 0.98
R2111:Cyp2e1 UTSW 7 140773634 missense probably damaging 1.00
R2230:Cyp2e1 UTSW 7 140764914 missense probably damaging 1.00
R2231:Cyp2e1 UTSW 7 140764914 missense probably damaging 1.00
R2383:Cyp2e1 UTSW 7 140770068 missense probably benign 0.06
R3778:Cyp2e1 UTSW 7 140763909 missense possibly damaging 0.58
R4082:Cyp2e1 UTSW 7 140771078 missense possibly damaging 0.67
R4707:Cyp2e1 UTSW 7 140763908 missense possibly damaging 0.58
R4751:Cyp2e1 UTSW 7 140774716 nonsense probably null
R4784:Cyp2e1 UTSW 7 140763908 missense possibly damaging 0.58
R4792:Cyp2e1 UTSW 7 140773675 missense probably benign
R4934:Cyp2e1 UTSW 7 140770117 missense probably damaging 1.00
R5092:Cyp2e1 UTSW 7 140774735 missense probably damaging 1.00
R5388:Cyp2e1 UTSW 7 140763993 missense probably damaging 1.00
R5423:Cyp2e1 UTSW 7 140770118 missense probably benign 0.01
R6740:Cyp2e1 UTSW 7 140763780 unclassified probably benign
R7065:Cyp2e1 UTSW 7 140763993 missense probably damaging 1.00
R7154:Cyp2e1 UTSW 7 140770137 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTCTGGGACTAAGGGCAAGG -3'
(R):5'- AGGAACTCCATATGCTTGGC -3'

Sequencing Primer
(F):5'- GATGGAGAATCCTGGTTTCAGTG -3'
(R):5'- TACAGATGGTTGTGAGCCACC -3'
Posted On2016-04-15