Incidental Mutation 'R4918:Hsf4'
ID378411
Institutional Source Beutler Lab
Gene Symbol Hsf4
Ensembl Gene ENSMUSG00000033249
Gene Nameheat shock transcription factor 4
Synonymsldis1
MMRRC Submission 042520-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4918 (G1)
Quality Score211
Status Validated
Chromosome8
Chromosomal Location105269801-105275845 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105272735 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 235 (E235G)
Ref Sequence ENSEMBL: ENSMUSP00000126278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014920] [ENSMUST00000036127] [ENSMUST00000036221] [ENSMUST00000126923] [ENSMUST00000163734] [ENSMUST00000172525] [ENSMUST00000173102] [ENSMUST00000173640] [ENSMUST00000173859] [ENSMUST00000174837]
Predicted Effect probably benign
Transcript: ENSMUST00000014920
SMART Domains Protein: ENSMUSP00000014920
Gene: ENSMUSG00000014776

DomainStartEndE-ValueType
CARD 4 92 2.1e-27 SMART
low complexity region 149 161 N/A INTRINSIC
low complexity region 173 209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036127
AA Change: E295G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048904
Gene: ENSMUSG00000033249
AA Change: E295G

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 383 8e-88 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000036221
SMART Domains Protein: ENSMUSP00000038638
Gene: ENSMUSG00000033313

DomainStartEndE-ValueType
FBOX 8 48 2.72e-6 SMART
low complexity region 102 113 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126923
SMART Domains Protein: ENSMUSP00000115366
Gene: ENSMUSG00000033313

DomainStartEndE-ValueType
FBOX 8 48 2.72e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163734
AA Change: E235G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000126278
Gene: ENSMUSG00000033249
AA Change: E235G

DomainStartEndE-ValueType
HSF 9 60 1.43e-1 SMART
Blast:HSF 99 323 2e-88 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172525
SMART Domains Protein: ENSMUSP00000134206
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 243 3e-36 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173102
Predicted Effect probably benign
Transcript: ENSMUST00000173640
SMART Domains Protein: ENSMUSP00000133532
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 284 1e-50 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173859
SMART Domains Protein: ENSMUSP00000134213
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 353 1e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174837
SMART Domains Protein: ENSMUSP00000134477
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 290 3e-50 BLAST
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 99% (116/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heat-shock transcription factors (HSFs) activate heat-shock response genes under conditions of heat or other stresses. HSF4 lacks the carboxyl-terminal hydrophobic repeat which is shared among all vertebrate HSFs and has been suggested to be involved in the negative regulation of DNA binding activity. Two alternatively spliced transcripts encoding distinct isoforms and possessing different transcriptional activity have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display abnormal lens morphology and cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T G 17: 28,908,363 Q224P probably benign Het
Abca6 T A 11: 110,180,551 I1492F probably damaging Het
Ago4 A C 4: 126,506,842 C693G probably damaging Het
Apobec2 T C 17: 48,423,125 E171G probably benign Het
Arfgef3 T A 10: 18,616,890 I1258F probably damaging Het
Arhgef40 A G 14: 51,990,099 E434G probably damaging Het
Baz2b T A 2: 59,914,043 T1373S possibly damaging Het
Bcas1 T C 2: 170,378,886 D324G probably damaging Het
Bdp1 A T 13: 100,055,205 V1422E probably damaging Het
Bfsp1 C T 2: 143,827,471 R396Q probably benign Het
Bnip1 C T 17: 26,783,551 probably benign Het
Bpifb9b T A 2: 154,314,106 probably null Het
Casp8 T C 1: 58,827,218 F126S probably damaging Het
Cdh26 T C 2: 178,449,821 S58P probably benign Het
Cntnap2 T C 6: 46,530,035 probably benign Het
Col9a1 T C 1: 24,237,258 I749T possibly damaging Het
Ddx50 A T 10: 62,627,671 C414* probably null Het
Defb42 A G 14: 63,048,341 I57V probably benign Het
Dennd5a A G 7: 109,901,089 F943S probably damaging Het
Dhx40 G T 11: 86,804,391 H98N possibly damaging Het
Disp2 A T 2: 118,790,454 S556C probably damaging Het
Dpysl5 T G 5: 30,792,268 F461V probably damaging Het
Efcab11 T C 12: 99,719,062 D151G probably damaging Het
Egfem1 T C 3: 29,151,893 V93A probably damaging Het
Ehbp1 T C 11: 22,146,592 D299G probably benign Het
Esyt2 T C 12: 116,324,140 V226A probably benign Het
Fan1 A T 7: 64,373,538 probably benign Het
Fasn T G 11: 120,816,646 N799T probably benign Het
Fbxo3 T G 2: 104,054,966 N388K probably damaging Het
Fer1l4 T C 2: 156,031,300 K1287E probably benign Het
Fn1 A T 1: 71,595,809 probably null Het
Fsip2 G A 2: 82,993,770 V6616I possibly damaging Het
Fut8 G T 12: 77,475,044 A486S probably damaging Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gm10764 A G 10: 87,290,717 noncoding transcript Het
Gm6788 C T 19: 28,763,264 noncoding transcript Het
Gm8122 T C 14: 43,234,116 N65S unknown Het
Golga4 C A 9: 118,558,145 S1445Y probably damaging Het
Gsdmd A G 15: 75,864,392 I123M probably benign Het
Ifi206 T A 1: 173,482,044 T129S possibly damaging Het
Jakmip1 G A 5: 37,091,275 R93Q probably damaging Het
Kcnj1 T A 9: 32,396,760 L160Q probably damaging Het
Kif1a T A 1: 93,074,978 E233V probably benign Het
Krt5 A T 15: 101,710,307 Y340N probably damaging Het
Krt90 T A 15: 101,562,479 H116L possibly damaging Het
Large2 A G 2: 92,366,107 probably benign Het
March4 T G 1: 72,428,779 S365R probably benign Het
Mei4 A G 9: 81,890,163 T10A probably benign Het
Meis1 T C 11: 19,009,222 probably benign Het
Mllt1 T C 17: 56,899,813 T344A probably benign Het
Mrps28 A G 3: 8,882,554 probably benign Het
Ncdn G A 4: 126,749,938 L364F possibly damaging Het
Nckap1l A G 15: 103,483,613 N825S probably benign Het
Nfat5 T A 8: 107,324,652 D47E probably damaging Het
Nfix T C 8: 84,771,829 I172V probably benign Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Nsf G A 11: 103,910,359 probably benign Het
Olfr1010 T C 2: 85,754,121 probably benign Het
Olfr1350 C T 7: 6,570,644 L218F possibly damaging Het
Olfr1459 T A 19: 13,145,991 I223L possibly damaging Het
Olfr353 A G 2: 36,890,332 I172T probably damaging Het
Olfr362 A T 2: 37,105,158 I164N possibly damaging Het
Olfr401 A T 11: 74,121,879 I197F probably benign Het
Olfr577 A T 7: 102,973,407 I195N possibly damaging Het
Olfr988 C T 2: 85,353,288 V213I probably benign Het
Pcdh20 A C 14: 88,467,668 L732R probably damaging Het
Pgbd5 C A 8: 124,370,566 K408N probably benign Het
Pip4k2c T C 10: 127,199,327 T391A possibly damaging Het
Ppm1k T A 6: 57,510,777 N354Y probably damaging Het
Prpf18 T C 2: 4,637,170 D186G probably benign Het
Rab3gap1 T A 1: 127,889,177 W58R possibly damaging Het
Rbp3 T C 14: 33,955,411 Y439H probably damaging Het
Rere T A 4: 150,619,144 W1528R probably damaging Het
Rsf1 T C 7: 97,662,405 S781P probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 A G 13: 11,594,986 V753A probably damaging Het
Schip1 A T 3: 68,408,485 probably benign Het
Scin T A 12: 40,069,374 I552F possibly damaging Het
Scn3a T C 2: 65,461,455 N1649S probably damaging Het
Sh3rf3 A T 10: 59,007,103 D297V probably damaging Het
Slc20a2 C T 8: 22,561,004 S351L probably damaging Het
Slc35e2 C A 4: 155,616,236 P272Q probably damaging Het
Slc4a1 A G 11: 102,352,453 V784A probably damaging Het
Slco1b2 G A 6: 141,669,370 V334I probably benign Het
Slf2 T G 19: 44,971,661 D1022E probably damaging Het
Spag6 A T 2: 18,745,549 I469F probably benign Het
Spsb2 A C 6: 124,809,748 E148A probably benign Het
Sulf1 A G 1: 12,818,496 D335G probably damaging Het
Tchhl1 A G 3: 93,470,316 D109G possibly damaging Het
Thoc7 T C 14: 13,953,154 I83V probably damaging Het
Thsd7a A C 6: 12,327,559 I1438S probably damaging Het
Tm4sf1 C T 3: 57,293,027 G85S probably damaging Het
Tmem63a T A 1: 180,966,521 I541N probably benign Het
Trav6d-4 T C 14: 52,753,783 F95S probably damaging Het
Ttn T C 2: 76,759,254 T21219A probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Unc80 T C 1: 66,646,550 Y2278H possibly damaging Het
Usp8 A T 2: 126,720,140 K85* probably null Het
Vmn2r69 T A 7: 85,406,759 M724L probably benign Het
Zeb2 A G 2: 44,996,882 I706T probably damaging Het
Zfp512 T C 5: 31,476,865 S407P probably damaging Het
Zfp791 T A 8: 85,110,951 I95L probably benign Het
Other mutations in Hsf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Hsf4 APN 8 105275657 makesense probably null
IGL01702:Hsf4 APN 8 105271589 missense probably damaging 1.00
IGL02040:Hsf4 APN 8 105275667 unclassified probably benign
R0115:Hsf4 UTSW 8 105272704 critical splice acceptor site probably null
R0449:Hsf4 UTSW 8 105275590 missense probably benign 0.04
R0585:Hsf4 UTSW 8 105271031 missense probably damaging 1.00
R1365:Hsf4 UTSW 8 105271094 missense probably damaging 0.99
R1401:Hsf4 UTSW 8 105275603 missense probably benign
R2276:Hsf4 UTSW 8 105269996 missense probably null 0.91
R2278:Hsf4 UTSW 8 105269996 missense probably null 0.91
R3848:Hsf4 UTSW 8 105270837 missense probably damaging 1.00
R3850:Hsf4 UTSW 8 105270837 missense probably damaging 1.00
R4240:Hsf4 UTSW 8 105274881 missense possibly damaging 0.58
R4781:Hsf4 UTSW 8 105274752 critical splice donor site probably null
R4790:Hsf4 UTSW 8 105270605 missense probably damaging 1.00
R4917:Hsf4 UTSW 8 105272735 missense probably benign 0.00
R4930:Hsf4 UTSW 8 105272698 splice site probably null
R5110:Hsf4 UTSW 8 105272795 missense probably benign 0.01
R5189:Hsf4 UTSW 8 105271428 frame shift probably null
R6001:Hsf4 UTSW 8 105272909 missense possibly damaging 0.70
R6167:Hsf4 UTSW 8 105270849 missense probably damaging 1.00
R6802:Hsf4 UTSW 8 105274668 missense probably damaging 1.00
R7231:Hsf4 UTSW 8 105272147 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCCCATCATCTCTGACATC -3'
(R):5'- TTCAGGCTGTTGTACACTCC -3'

Sequencing Primer
(F):5'- TGAAGGACACAGGCTTTCTC -3'
(R):5'- GCTGTTGTACACTCCTGGGC -3'
Posted On2016-04-15