Incidental Mutation 'R4920:1700092K14Rik'
List |< first << previous [record 21 of 1920] next >> last >|
ID378522
Institutional Source Beutler Lab
Gene Symbol 1700092K14Rik
Ensembl Gene ENSMUSG00000078600
Gene NameRIKEN cDNA 1700092K14 gene
Synonyms
MMRRC Submission 042522-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R4920 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location114198258-114199199 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to T at 114199045 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106604
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 87.9%
Validation Efficiency 96% (55/57)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Apbb1ip A G 2: 22,819,684 D51G unknown Het
Arntl A G 7: 113,285,114 T120A probably damaging Het
Brca1 A T 11: 101,524,959 V783D probably damaging Het
Ccdc141 T C 2: 77,168,563 D58G probably damaging Het
Ccr9 G T 9: 123,779,439 G62V probably damaging Het
Ces2b T C 8: 104,836,906 Y422H probably benign Het
Cpa4 T C 6: 30,568,463 probably null Het
Dennd3 A G 15: 73,540,725 H412R probably benign Het
Dpy19l3 A T 7: 35,708,042 probably benign Het
Dtwd2 G T 18: 49,698,440 R167S possibly damaging Het
Dync1i2 G A 2: 71,247,324 R243Q probably damaging Het
Ear2 G A 14: 44,103,125 G80E probably damaging Het
Fam171b A G 2: 83,880,359 K792E possibly damaging Het
Fam83b G A 9: 76,491,868 T651I probably benign Het
Fcrl5 T G 3: 87,444,173 F243V probably damaging Het
Galntl6 T C 8: 58,427,773 I115M probably damaging Het
Glrx3 A G 7: 137,464,130 D163G probably null Het
Gm13089 T C 4: 143,699,283 D30G probably benign Het
Gm14488 A T 2: 30,715,032 noncoding transcript Het
Gm973 T C 1: 59,627,566 S683P probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Gsdmd T C 15: 75,864,357 S112P probably damaging Het
Ighv14-3 A G 12: 114,060,257 V6A probably benign Het
Lca5l T A 16: 96,178,835 S32C probably damaging Het
Lrba T A 3: 86,664,458 Y260* probably null Het
Lyst T C 13: 13,647,060 S1340P possibly damaging Het
Mfsd13a T G 19: 46,367,216 F59V probably damaging Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Noa1 T C 5: 77,306,487 probably null Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Papd4 G A 13: 93,186,325 Q39* probably null Het
Pgm2 C T 4: 99,986,733 T571M probably damaging Het
Rfc1 C A 5: 65,287,928 V460F probably damaging Het
Rrn3 A G 16: 13,790,639 D182G probably benign Het
Sap25 T A 5: 137,642,245 probably benign Het
Slc9a2 A G 1: 40,755,718 I480V probably benign Het
Smo T C 6: 29,759,594 S642P probably damaging Het
Tbc1d22a A C 15: 86,311,748 I307L probably benign Het
Ubr3 A G 2: 69,952,868 Q716R probably benign Het
Vmn2r96 A G 17: 18,582,656 E276G probably benign Het
Zfp189 G A 4: 49,529,302 C135Y probably damaging Het
Other mutations in 1700092K14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4282:1700092K14Rik UTSW 11 114199144 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- ACCTTGAGTGGTCCTGAGTG -3'
(R):5'- CCCATAAGATCACAGGACGAGATAG -3'

Sequencing Primer
(F):5'- AGTGAGTATACAGATCTGTGCCTCC -3'
(R):5'- CGGCAAAGCAAACCGTCAGG -3'
Posted On2016-04-15