Incidental Mutation 'R4921:Frem3'
ID378592
Institutional Source Beutler Lab
Gene Symbol Frem3
Ensembl Gene ENSMUSG00000042353
Gene NameFras1 related extracellular matrix protein 3
SynonymsLOC333315
MMRRC Submission 042523-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R4921 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location80611080-80695356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80613136 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 686 (I686N)
Ref Sequence ENSEMBL: ENSMUSP00000038015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039695]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039695
AA Change: I686N

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038015
Gene: ENSMUSG00000042353
AA Change: I686N

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cadherin_3 369 515 9.5e-31 PFAM
Pfam:Cadherin_3 495 596 9.4e-20 PFAM
Pfam:Cadherin_3 637 786 4.2e-20 PFAM
Pfam:Cadherin_3 788 913 5.5e-23 PFAM
Pfam:Cadherin_3 998 1163 1.8e-20 PFAM
Pfam:Cadherin_3 1129 1254 1.3e-19 PFAM
Pfam:Cadherin_3 1250 1395 9.5e-34 PFAM
Pfam:Cadherin_3 1397 1508 2.7e-21 PFAM
Pfam:Cadherin_3 1493 1617 1.2e-27 PFAM
Pfam:Cadherin_3 1622 1748 4.8e-17 PFAM
Calx_beta 1754 1853 1.45e-7 SMART
Calx_beta 1866 1977 3.35e-12 SMART
Calx_beta 1991 2098 1.61e-5 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The protein belongs to the family of FRAS1/FREM extracellular matrix proteins and may play a role cell adhesion. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,796 N65K probably benign Het
Abcc9 T C 6: 142,590,436 Y1524C probably benign Het
Acap1 A G 11: 69,887,193 I102T probably damaging Het
Acvr2a T C 2: 48,893,541 V284A possibly damaging Het
Adam3 T C 8: 24,684,614 M712V probably benign Het
Adck1 T C 12: 88,441,138 V213A probably benign Het
Adgrl3 G T 5: 81,512,110 W242L probably damaging Het
Alk T C 17: 71,904,315 T857A probably benign Het
Alms1 A G 6: 85,628,546 T2393A probably benign Het
Ank3 C T 10: 70,002,109 P240L probably damaging Het
Ankrd35 C A 3: 96,684,824 L809M possibly damaging Het
Birc6 T A 17: 74,650,099 L3690Q probably damaging Het
Bmp3 C A 5: 98,872,061 F114L probably damaging Het
Cage1 G A 13: 38,019,208 H627Y probably benign Het
Cars T C 7: 143,569,475 D468G probably damaging Het
Ccdc148 T C 2: 58,829,802 E487G probably damaging Het
Ccdc80 A T 16: 45,118,167 I746F probably damaging Het
Ccl25 A G 8: 4,353,913 Q119R possibly damaging Het
Cdh24 C T 14: 54,633,215 D178N probably damaging Het
Cdk12 A T 11: 98,222,687 T766S unknown Het
Chst15 T A 7: 132,247,884 T443S probably benign Het
Cnbp T C 6: 87,845,146 D125G possibly damaging Het
Cntn2 A T 1: 132,516,032 V1003E possibly damaging Het
Crct1 A G 3: 93,014,825 probably benign Het
Dand5 C T 8: 84,816,484 C121Y probably damaging Het
Dmkn A T 7: 30,771,233 D382V probably damaging Het
Dnase2b T A 3: 146,593,441 T86S probably damaging Het
Dusp8 GCCACCACCACCACCACCACCACC GCCACCACCACCACCACCACC 7: 142,082,154 probably benign Het
Eef1akmt1 C T 14: 57,550,632 V90M probably damaging Het
Egfl7 G T 2: 26,590,980 W168L probably benign Het
Ep400 A G 5: 110,665,810 C2908R probably damaging Het
Espl1 A G 15: 102,315,241 K1076E probably damaging Het
Exoc4 A G 6: 33,910,517 N747D probably benign Het
Fancm T C 12: 65,077,141 V191A probably benign Het
Fbxo17 A G 7: 28,732,789 D97G probably benign Het
Fer1l6 G T 15: 58,600,311 probably null Het
Flt4 T C 11: 49,627,143 W337R probably damaging Het
Fpr-rs7 T C 17: 20,113,820 H136R possibly damaging Het
Galnt9 A G 5: 110,577,449 K84R probably damaging Het
Gfm2 T A 13: 97,175,676 M760K probably damaging Het
Glis3 T C 19: 28,666,104 T13A probably damaging Het
Gm13078 A T 4: 143,728,326 K398M possibly damaging Het
H2-K1 A G 17: 33,997,076 V323A possibly damaging Het
Hbb-bs G A 7: 103,826,720 A130V probably damaging Het
Herc2 T A 7: 56,229,690 H4685Q probably benign Het
Ighv5-9-1 C T 12: 113,736,294 R56H possibly damaging Het
Itgb4 A G 11: 116,006,605 N1548S probably benign Het
Itpr3 T C 17: 27,098,005 Y745H probably damaging Het
Kank3 G T 17: 33,817,200 G14V probably damaging Het
Kif24 G T 4: 41,394,329 S982Y probably damaging Het
Kifc5b C T 17: 26,921,023 R53W probably damaging Het
Krt39 A G 11: 99,514,749 S442P possibly damaging Het
Lcat G A 8: 105,942,442 P67L possibly damaging Het
Maml2 T C 9: 13,621,175 S562P probably damaging Het
Map3k8 G A 18: 4,349,124 R65W possibly damaging Het
Mbd3 G T 10: 80,395,576 R12S probably damaging Het
Msr1 T C 8: 39,624,251 E106G possibly damaging Het
Myh4 T A 11: 67,254,028 L1256Q probably damaging Het
Mypn G A 10: 63,147,936 T511M possibly damaging Het
Nub1 A T 5: 24,701,469 N331I probably benign Het
Nup107 A G 10: 117,770,511 V440A possibly damaging Het
Ofcc1 A G 13: 40,214,517 F174L probably benign Het
Olfr1497 T C 19: 13,795,465 I49V probably benign Het
Olfr597 A T 7: 103,320,543 N44I probably damaging Het
Olfr975 A C 9: 39,950,225 V182G probably damaging Het
Parp2 C A 14: 50,819,268 L310I probably damaging Het
Pcdh20 A G 14: 88,469,726 V46A probably benign Het
Pcdhgb6 A G 18: 37,743,472 D411G probably damaging Het
Pkd1l2 A T 8: 117,072,549 N267K probably damaging Het
Pkd1l2 T C 8: 117,054,885 E807G probably benign Het
Rell1 C A 5: 63,936,033 M126I probably damaging Het
Robo4 G A 9: 37,402,560 E36K probably benign Het
Rpgrip1l T C 8: 91,261,009 S807G probably benign Het
Rpl10a T C 17: 28,330,852 V169A probably benign Het
Rubcn C T 16: 32,847,294 V166I probably damaging Het
Sall2 T C 14: 52,315,393 E113G possibly damaging Het
Sars2 T C 7: 28,752,438 S423P possibly damaging Het
Scaper A G 9: 55,892,235 I182T probably benign Het
Selp A G 1: 164,141,397 D522G possibly damaging Het
Sema4b T A 7: 80,198,756 I35N possibly damaging Het
Sgce A T 6: 4,694,153 F268I probably damaging Het
Slc14a2 G T 18: 78,192,188 A258E probably damaging Het
Slc17a9 T C 2: 180,735,949 Y213H probably benign Het
Slc22a7 T G 17: 46,436,933 I233L probably benign Het
Slc35f1 A G 10: 53,062,602 Q210R probably damaging Het
Slc6a21 A G 7: 45,288,310 E350G possibly damaging Het
Spata21 A T 4: 141,112,091 D639V probably damaging Het
Svil A G 18: 5,108,631 D1519G probably damaging Het
Tbccd1 T C 16: 22,841,899 T56A probably benign Het
Tigit A T 16: 43,662,017 I118N probably damaging Het
Tlr11 A T 14: 50,362,885 Q776L possibly damaging Het
Tspan12 A C 6: 21,835,449 I9S possibly damaging Het
Unc5c T A 3: 141,788,966 Y347N probably damaging Het
Unk A G 11: 116,054,945 T481A probably benign Het
Vmn1r192 A C 13: 22,187,480 V190G probably damaging Het
Vnn3 A T 10: 23,864,575 M259L probably benign Het
Zan T C 5: 137,408,370 probably benign Het
Zdhhc6 T C 19: 55,313,210 H113R probably damaging Het
Other mutations in Frem3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Frem3 APN 8 80668810 missense possibly damaging 0.75
IGL01019:Frem3 APN 8 80615134 missense probably benign 0.02
IGL01470:Frem3 APN 8 80614315 missense probably damaging 1.00
IGL01609:Frem3 APN 8 80612704 missense probably benign 0.00
IGL01622:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01623:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01751:Frem3 APN 8 80615743 missense probably benign 0.33
IGL02037:Frem3 APN 8 80611489 missense probably benign 0.31
IGL02039:Frem3 APN 8 80612971 missense probably damaging 1.00
IGL02084:Frem3 APN 8 80612443 missense possibly damaging 0.95
IGL02124:Frem3 APN 8 80613094 missense probably damaging 0.99
IGL02140:Frem3 APN 8 80614107 missense possibly damaging 0.84
IGL02836:Frem3 APN 8 80614381 missense probably benign
IGL03090:Frem3 APN 8 80618229 missense probably benign 0.01
IGL03102:Frem3 APN 8 80613032 missense possibly damaging 0.92
IGL03116:Frem3 APN 8 80612806 missense possibly damaging 0.84
IGL03165:Frem3 APN 8 80612529 missense probably benign 0.26
IGL03224:Frem3 APN 8 80613463 missense probably damaging 1.00
IGL03401:Frem3 APN 8 80614541 missense probably damaging 1.00
IGL03403:Frem3 APN 8 80611090 missense probably benign 0.04
FR4340:Frem3 UTSW 8 80615241 small insertion probably benign
FR4976:Frem3 UTSW 8 80615241 small insertion probably benign
IGL02991:Frem3 UTSW 8 80668882 missense probably damaging 1.00
IGL03052:Frem3 UTSW 8 80614530 missense probably damaging 1.00
R0089:Frem3 UTSW 8 80615878 missense possibly damaging 0.94
R0647:Frem3 UTSW 8 80615185 missense probably damaging 1.00
R0690:Frem3 UTSW 8 80613952 missense possibly damaging 0.84
R0766:Frem3 UTSW 8 80615322 missense probably benign
R0834:Frem3 UTSW 8 80687008 missense probably damaging 1.00
R0909:Frem3 UTSW 8 80663406 missense probably benign 0.45
R1033:Frem3 UTSW 8 80695157 missense probably benign 0.00
R1144:Frem3 UTSW 8 80611884 missense probably benign 0.01
R1312:Frem3 UTSW 8 80615322 missense probably benign
R1330:Frem3 UTSW 8 80668839 missense probably damaging 0.99
R1355:Frem3 UTSW 8 80690702 missense probably damaging 1.00
R1390:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R1413:Frem3 UTSW 8 80668801 missense probably benign
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1503:Frem3 UTSW 8 80687018 missense probably damaging 0.99
R1538:Frem3 UTSW 8 80612710 missense probably damaging 1.00
R1538:Frem3 UTSW 8 80613135 missense probably benign 0.00
R1612:Frem3 UTSW 8 80614861 missense probably damaging 1.00
R1793:Frem3 UTSW 8 80613112 missense probably benign 0.03
R1872:Frem3 UTSW 8 80612576 missense probably damaging 1.00
R1879:Frem3 UTSW 8 80611938 nonsense probably null
R1886:Frem3 UTSW 8 80613885 missense probably benign 0.00
R1933:Frem3 UTSW 8 80612890 missense probably benign 0.00
R2027:Frem3 UTSW 8 80695337 missense possibly damaging 0.75
R2040:Frem3 UTSW 8 80615826 missense possibly damaging 0.92
R2050:Frem3 UTSW 8 80614891 missense probably damaging 1.00
R2079:Frem3 UTSW 8 80615103 missense probably benign 0.03
R2099:Frem3 UTSW 8 80615859 missense probably benign 0.06
R2120:Frem3 UTSW 8 80615457 missense probably benign 0.20
R2842:Frem3 UTSW 8 80669349 intron probably null
R2845:Frem3 UTSW 8 80613220 missense probably damaging 1.00
R3015:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R3442:Frem3 UTSW 8 80613040 missense probably damaging 1.00
R3724:Frem3 UTSW 8 80615271 missense probably benign 0.06
R3730:Frem3 UTSW 8 80615916 missense probably damaging 0.99
R3939:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3940:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3941:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R4089:Frem3 UTSW 8 80615173 missense probably damaging 1.00
R4282:Frem3 UTSW 8 80614141 missense probably benign 0.00
R4437:Frem3 UTSW 8 80612607 missense probably benign 0.30
R4480:Frem3 UTSW 8 80611357 missense probably benign 0.10
R4575:Frem3 UTSW 8 80616075 missense probably benign 0.17
R4583:Frem3 UTSW 8 80613514 missense probably benign 0.03
R4620:Frem3 UTSW 8 80668957 missense possibly damaging 0.82
R4621:Frem3 UTSW 8 80669191 splice site probably null
R4644:Frem3 UTSW 8 80613727 missense probably benign 0.33
R4667:Frem3 UTSW 8 80663420 missense probably damaging 0.97
R4748:Frem3 UTSW 8 80611459 missense probably damaging 1.00
R4823:Frem3 UTSW 8 80613958 missense probably benign 0.25
R4836:Frem3 UTSW 8 80663397 missense probably damaging 0.99
R4867:Frem3 UTSW 8 80613283 missense probably damaging 1.00
R5030:Frem3 UTSW 8 80613247 missense possibly damaging 0.89
R5035:Frem3 UTSW 8 80615914 missense probably damaging 0.97
R5172:Frem3 UTSW 8 80612566 missense probably benign 0.44
R5289:Frem3 UTSW 8 80612319 missense probably benign 0.00
R5492:Frem3 UTSW 8 80612677 missense probably damaging 1.00
R5655:Frem3 UTSW 8 80612694 missense probably benign 0.00
R5685:Frem3 UTSW 8 80695303 missense probably damaging 1.00
R5723:Frem3 UTSW 8 80613397 missense probably benign 0.02
R5743:Frem3 UTSW 8 80615778 missense probably damaging 0.98
R5889:Frem3 UTSW 8 80614288 missense probably damaging 1.00
R6048:Frem3 UTSW 8 80613433 missense probably benign 0.03
R6057:Frem3 UTSW 8 80615587 missense probably damaging 0.99
R6137:Frem3 UTSW 8 80615047 missense probably benign
R6264:Frem3 UTSW 8 80615203 missense probably damaging 1.00
R6339:Frem3 UTSW 8 80613015 missense possibly damaging 0.84
R6418:Frem3 UTSW 8 80611152 missense probably benign 0.08
R6680:Frem3 UTSW 8 80669320 missense probably damaging 1.00
R6773:Frem3 UTSW 8 80611815 missense probably damaging 1.00
R6838:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R6928:Frem3 UTSW 8 80611282 missense possibly damaging 0.48
R6939:Frem3 UTSW 8 80615145 missense probably benign 0.23
R6995:Frem3 UTSW 8 80612579 missense probably damaging 0.98
R7112:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7155:Frem3 UTSW 8 80616039 missense probably benign 0.01
R7235:Frem3 UTSW 8 80690725 missense probably benign 0.00
R7282:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7403:Frem3 UTSW 8 80616145 missense probably damaging 1.00
R7422:Frem3 UTSW 8 80615763 missense probably benign 0.00
R7485:Frem3 UTSW 8 80613336 missense probably damaging 1.00
R7516:Frem3 UTSW 8 80612083 missense not run
X0024:Frem3 UTSW 8 80613081 missense possibly damaging 0.76
X0027:Frem3 UTSW 8 80612388 nonsense probably null
Z1088:Frem3 UTSW 8 80615426 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCCCTTCTGTACAGTGACTGGC -3'
(R):5'- ACTTGATGGTTGCTGTCAGC -3'

Sequencing Primer
(F):5'- TGACTGGCACTATGTGGAAAAG -3'
(R):5'- CAGCGTCTGTTGGTCGC -3'
Posted On2016-04-15