Incidental Mutation 'R4922:Cic'
ID378694
Institutional Source Beutler Lab
Gene Symbol Cic
Ensembl Gene ENSMUSG00000005442
Gene Namecapicua transcriptional repressor
Synonyms1200010B10Rik
MMRRC Submission 042524-MU
Accession Numbers

Genbank: NM_027882.3, NM_001110131.1, NM_001110132.1; Ensembl: ENSMUST00000169266

Is this an essential gene? Possibly essential (E-score: 0.730) question?
Stock #R4922 (G1)
Quality Score126
Status Not validated
Chromosome7
Chromosomal Location25267704-25294159 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) TCCCCC to TCCCCCCCC at 25291670 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005578] [ENSMUST00000005583] [ENSMUST00000108410] [ENSMUST00000148150] [ENSMUST00000155118] [ENSMUST00000163320] [ENSMUST00000164820] [ENSMUST00000165239] [ENSMUST00000169266]
Predicted Effect probably benign
Transcript: ENSMUST00000005578
SMART Domains Protein: ENSMUSP00000005578
Gene: ENSMUSG00000005442

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 6e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1065 1080 N/A INTRINSIC
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1135 1155 N/A INTRINSIC
low complexity region 1223 1253 N/A INTRINSIC
low complexity region 1280 1313 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1483 1494 N/A INTRINSIC
low complexity region 1524 1547 N/A INTRINSIC
low complexity region 1568 1603 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000005583
SMART Domains Protein: ENSMUSP00000005583
Gene: ENSMUSG00000005447

DomainStartEndE-ValueType
Pfam:Lipase_GDSL_2 12 203 3.8e-13 PFAM
Pfam:Lipase_GDSL 42 209 1.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108410
SMART Domains Protein: ENSMUSP00000104048
Gene: ENSMUSG00000005447

DomainStartEndE-ValueType
Pfam:Lipase_GDSL_2 4 151 1.2e-23 PFAM
low complexity region 155 166 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140093
Predicted Effect probably benign
Transcript: ENSMUST00000148150
SMART Domains Protein: ENSMUSP00000121250
Gene: ENSMUSG00000005447

DomainStartEndE-ValueType
Pfam:Lipase_GDSL_2 43 143 5.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148828
Predicted Effect probably benign
Transcript: ENSMUST00000155118
SMART Domains Protein: ENSMUSP00000120379
Gene: ENSMUSG00000005447

DomainStartEndE-ValueType
Pfam:Lipase_GDSL_2 43 149 2.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163320
SMART Domains Protein: ENSMUSP00000126659
Gene: ENSMUSG00000005442

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 6e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1064 1079 N/A INTRINSIC
low complexity region 1117 1131 N/A INTRINSIC
low complexity region 1134 1154 N/A INTRINSIC
low complexity region 1222 1252 N/A INTRINSIC
low complexity region 1279 1312 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1483 1494 N/A INTRINSIC
low complexity region 1524 1547 N/A INTRINSIC
low complexity region 1568 1603 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163901
SMART Domains Protein: ENSMUSP00000127858
Gene: ENSMUSG00000005442

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
low complexity region 114 128 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164820
SMART Domains Protein: ENSMUSP00000130146
Gene: ENSMUSG00000005442

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
low complexity region 39 57 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165239
SMART Domains Protein: ENSMUSP00000128071
Gene: ENSMUSG00000005442

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 5e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1065 1080 N/A INTRINSIC
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1135 1153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167379
Predicted Effect probably benign
Transcript: ENSMUST00000169266
SMART Domains Protein: ENSMUSP00000132351
Gene: ENSMUSG00000005442

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
low complexity region 33 73 N/A INTRINSIC
low complexity region 151 165 N/A INTRINSIC
Pfam:DUF4819 249 346 1.8e-23 PFAM
low complexity region 351 367 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
low complexity region 445 457 N/A INTRINSIC
low complexity region 462 475 N/A INTRINSIC
low complexity region 618 633 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 724 734 N/A INTRINSIC
low complexity region 740 751 N/A INTRINSIC
low complexity region 779 786 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
low complexity region 898 911 N/A INTRINSIC
PDB:4J2L|D 930 955 5e-10 PDB
low complexity region 1013 1027 N/A INTRINSIC
low complexity region 1031 1045 N/A INTRINSIC
HMG 1106 1176 1.24e-17 SMART
low complexity region 1322 1338 N/A INTRINSIC
low complexity region 1380 1393 N/A INTRINSIC
low complexity region 1415 1428 N/A INTRINSIC
low complexity region 1432 1462 N/A INTRINSIC
low complexity region 1474 1490 N/A INTRINSIC
low complexity region 1552 1567 N/A INTRINSIC
low complexity region 1636 1647 N/A INTRINSIC
low complexity region 1689 1710 N/A INTRINSIC
low complexity region 1744 1766 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
low complexity region 1971 1986 N/A INTRINSIC
low complexity region 2024 2038 N/A INTRINSIC
low complexity region 2041 2061 N/A INTRINSIC
low complexity region 2129 2159 N/A INTRINSIC
low complexity region 2186 2219 N/A INTRINSIC
low complexity region 2311 2324 N/A INTRINSIC
low complexity region 2389 2400 N/A INTRINSIC
low complexity region 2430 2453 N/A INTRINSIC
low complexity region 2474 2509 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170500
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ortholog of the Drosophila melanogaster capicua gene, and is a member of the high mobility group (HMG)-box superfamily of transcriptional repressors. This protein contains a conserved HMG domain that is involved in DNA binding and nuclear localization, and a conserved C-terminus. Studies suggest that the N-terminal region of this protein interacts with Atxn1 (GeneID:6310), to form a transcription repressor complex, and in vitro studies suggest that polyglutamine-expansion of ATXN1 may alter the repressor activity of this complex. Mutations in this gene have been associated with olidogdendrogliomas (PMID:21817013). In addition, translocation events resulting in gene fusions of this gene with both DUX4 (GeneID:100288687) and FOXO4 (GeneID:4303) have been associated with round cell sarcomas. There are multiple pseudogenes of this gene found on chromosomes 1, 4, 6, 7, 16, 20, and the Y chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit partial postnatal lethality, decreased body size, and severe lung alveolarization defects. [provided by MGI curators]
Allele List at MGI

All alleles(61) : Targeted, other(4) Gene trapped(57)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900011O08Rik A G 16: 13,986,819 H10R possibly damaging Het
4932438A13Rik T A 3: 36,987,165 I2564K probably damaging Het
5830473C10Rik A G 5: 90,579,711 H396R possibly damaging Het
Adgrb2 G T 4: 130,007,852 C423F probably damaging Het
Akap11 A T 14: 78,512,780 Y722* probably null Het
Anxa3 A T 5: 96,820,429 I114F probably damaging Het
Arfgef3 T A 10: 18,592,186 R1755S probably damaging Het
Atf7ip A T 6: 136,560,041 T91S possibly damaging Het
B020004J07Rik T A 4: 101,835,532 M424L probably benign Het
Bcl2 C A 1: 106,712,646 A79S probably benign Het
Bmp10 C T 6: 87,433,575 P117S probably benign Het
Bmpr2 A G 1: 59,867,424 T559A probably benign Het
Cd200r1 A T 16: 44,789,676 Y86F probably damaging Het
Cemip T A 7: 83,947,100 probably benign Het
Cfap52 A G 11: 67,931,722 probably null Het
Chml T C 1: 175,687,146 H60R possibly damaging Het
Clec12a A G 6: 129,359,478 Y201C probably damaging Het
Col15a1 T C 4: 47,258,719 V370A probably benign Het
Cpsf3 T C 12: 21,301,537 I353T probably damaging Het
Csf2rb T A 15: 78,346,467 V470E probably benign Het
Cyp4a10 C A 4: 115,521,094 Q126K probably benign Het
Dennd1b T C 1: 139,085,914 S249P probably damaging Het
Dnase2a A G 8: 84,908,996 probably null Het
Dpp10 T C 1: 123,378,153 N490S probably benign Het
Enc1 C T 13: 97,245,735 A251V probably benign Het
Fancd2 T C 6: 113,585,473 V1258A probably benign Het
Fancm G A 12: 65,106,892 probably null Het
Fbxo16 C T 14: 65,299,208 T177I probably benign Het
Gm10471 A T 5: 26,084,793 I212N probably damaging Het
Gm1965 T C 6: 89,146,543 noncoding transcript Het
Gm6768 A G 12: 119,262,517 noncoding transcript Het
Hal A T 10: 93,503,539 M497L probably damaging Het
Hectd4 T C 5: 121,359,315 L3936S possibly damaging Het
Hs3st4 G T 7: 124,397,187 G359W probably damaging Het
Il6st C T 13: 112,502,865 P608L probably damaging Het
Kctd18 A C 1: 57,965,548 probably benign Het
Kntc1 T A 5: 123,802,246 S1636T probably damaging Het
Lrrn1 A T 6: 107,568,350 S370C probably damaging Het
Mtcl1 A C 17: 66,348,479 C968G probably benign Het
Mylip G A 13: 45,408,762 A347T probably damaging Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Neu4 T A 1: 94,022,478 V53E probably damaging Het
Nxpe3 T C 16: 55,860,324 I302V probably benign Het
Olfr1229 A T 2: 89,282,467 L243Q possibly damaging Het
Olfr266 A T 3: 106,822,260 C100S probably damaging Het
Otos T C 1: 92,644,368 T79A probably damaging Het
Pde4a T C 9: 21,210,713 I578T probably damaging Het
Prex2 C T 1: 11,169,940 P927S probably damaging Het
Prrxl1 A T 14: 32,608,406 N160I probably damaging Het
Prune2 A T 19: 17,122,752 K1873N probably benign Het
Ptk7 C A 17: 46,576,491 probably null Het
Reln T A 5: 21,995,587 probably null Het
Rgl2 A G 17: 33,932,775 probably benign Het
Rnf145 T A 11: 44,557,236 probably benign Het
Ryr2 T C 13: 11,709,963 E2488G probably damaging Het
Sgo2b A T 8: 63,926,630 M1056K possibly damaging Het
Snapc4 A G 2: 26,369,233 V635A probably benign Het
Snx19 T A 9: 30,437,467 Y101N probably benign Het
Sorl1 C A 9: 42,014,450 probably null Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Tmem30b G A 12: 73,545,714 P209L probably damaging Het
Trbv12-2 G T 6: 41,119,147 C52F probably damaging Het
Tsc2 T A 17: 24,600,369 D1304V probably benign Het
Ugt2b36 T C 5: 87,066,324 Y487C probably damaging Het
Vmn1r10 T A 6: 57,113,826 N134K probably damaging Het
Wdr27 C A 17: 14,920,754 probably null Het
Wdr66 T C 5: 123,256,053 V335A probably benign Het
Wdr75 T C 1: 45,816,478 F430L probably damaging Het
Zfp629 A G 7: 127,612,127 I170T probably damaging Het
Other mutations in Cic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cic APN 7 25292124 missense probably damaging 1.00
IGL01668:Cic APN 7 25291204 missense possibly damaging 0.47
IGL02229:Cic APN 7 25290950 missense probably damaging 0.96
IGL02506:Cic APN 7 25290857 missense probably benign
IGL02794:Cic APN 7 25285644 missense probably damaging 1.00
IGL03065:Cic APN 7 25285821 splice site probably benign
IGL03304:Cic APN 7 25284849 missense probably damaging 1.00
1mM(1):Cic UTSW 7 25290789 splice site probably benign
IGL03046:Cic UTSW 7 25291075 missense probably damaging 1.00
R0012:Cic UTSW 7 25287140 missense probably damaging 0.98
R0012:Cic UTSW 7 25287141 missense probably damaging 1.00
R0027:Cic UTSW 7 25287140 missense probably damaging 0.98
R0027:Cic UTSW 7 25287141 missense probably damaging 1.00
R0038:Cic UTSW 7 25287140 missense probably damaging 0.98
R0038:Cic UTSW 7 25287141 missense probably damaging 1.00
R0063:Cic UTSW 7 25287140 missense probably damaging 0.98
R0063:Cic UTSW 7 25287141 missense probably damaging 1.00
R0064:Cic UTSW 7 25287140 missense probably damaging 0.98
R0064:Cic UTSW 7 25287141 missense probably damaging 1.00
R0118:Cic UTSW 7 25286034 missense probably damaging 1.00
R0193:Cic UTSW 7 25287140 missense probably damaging 0.98
R0193:Cic UTSW 7 25287141 missense probably damaging 1.00
R0241:Cic UTSW 7 25287140 missense probably damaging 0.98
R0241:Cic UTSW 7 25287141 missense probably damaging 1.00
R0377:Cic UTSW 7 25285799 missense probably damaging 0.98
R0462:Cic UTSW 7 25287140 missense probably damaging 0.98
R0462:Cic UTSW 7 25287141 missense probably damaging 1.00
R0800:Cic UTSW 7 25285237 missense probably benign
R1253:Cic UTSW 7 25290948 missense probably damaging 1.00
R1458:Cic UTSW 7 25279737 intron probably benign
R1462:Cic UTSW 7 25271607 missense probably damaging 0.98
R1462:Cic UTSW 7 25271607 missense probably damaging 0.98
R1519:Cic UTSW 7 25293810 critical splice acceptor site probably null
R1586:Cic UTSW 7 25285961 missense probably damaging 1.00
R1824:Cic UTSW 7 25288266 missense probably damaging 1.00
R1908:Cic UTSW 7 25286840 missense probably damaging 1.00
R2045:Cic UTSW 7 25271536 missense possibly damaging 0.53
R2063:Cic UTSW 7 25273451 missense probably damaging 0.98
R2161:Cic UTSW 7 25288134 unclassified probably null
R2495:Cic UTSW 7 25291776 splice site probably benign
R2865:Cic UTSW 7 25273221 missense probably damaging 0.96
R3692:Cic UTSW 7 25288913 nonsense probably null
R3709:Cic UTSW 7 25286981 missense probably damaging 0.99
R3710:Cic UTSW 7 25286981 missense probably damaging 0.99
R3872:Cic UTSW 7 25271699 missense possibly damaging 0.92
R3946:Cic UTSW 7 25272346 missense possibly damaging 0.93
R4199:Cic UTSW 7 25291670 frame shift probably null
R4426:Cic UTSW 7 25294008 utr 3 prime probably benign
R4502:Cic UTSW 7 25288467 missense probably damaging 1.00
R4585:Cic UTSW 7 25272778 missense probably benign 0.33
R4586:Cic UTSW 7 25272778 missense probably benign 0.33
R4614:Cic UTSW 7 25291670 frame shift probably null
R4664:Cic UTSW 7 25290674 small deletion probably benign
R4688:Cic UTSW 7 25291670 frame shift probably null
R4695:Cic UTSW 7 25273588 missense possibly damaging 0.72
R4696:Cic UTSW 7 25288483 missense probably benign
R4746:Cic UTSW 7 25288480 missense probably damaging 1.00
R4758:Cic UTSW 7 25292211 missense possibly damaging 0.62
R4767:Cic UTSW 7 25271600 missense possibly damaging 0.92
R4776:Cic UTSW 7 25282883 missense possibly damaging 0.95
R4820:Cic UTSW 7 25271732 missense possibly damaging 0.92
R4850:Cic UTSW 7 25272902 missense probably damaging 0.98
R4851:Cic UTSW 7 25272902 missense probably damaging 0.98
R4989:Cic UTSW 7 25287110 missense probably damaging 1.00
R5131:Cic UTSW 7 25291670 small insertion probably benign
R5718:Cic UTSW 7 25272778 missense probably benign 0.33
R5801:Cic UTSW 7 25271438 missense possibly damaging 0.93
R5949:Cic UTSW 7 25272305 missense probably damaging 1.00
R6000:Cic UTSW 7 25271998 missense probably benign 0.33
R6246:Cic UTSW 7 25271642 missense probably damaging 1.00
R6283:Cic UTSW 7 25286034 missense probably damaging 1.00
R6364:Cic UTSW 7 25272823 missense possibly damaging 0.72
R6481:Cic UTSW 7 25288281 missense possibly damaging 0.56
R6919:Cic UTSW 7 25271777 missense probably benign 0.04
R6920:Cic UTSW 7 25290682 missense probably damaging 1.00
V7732:Cic UTSW 7 25292245 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTCCCCAGAAAGTAAAGGC -3'
(R):5'- TGAAGGCCAGGATACCCAGAAC -3'

Sequencing Primer
(F):5'- CAGCCATTGCCAGCATTC -3'
(R):5'- TCTCAAGTAGAATGGAATGGGTAC -3'
Posted On2016-04-15