Incidental Mutation 'R4923:Fcrla'
ID378737
Institutional Source Beutler Lab
Gene Symbol Fcrla
Ensembl Gene ENSMUSG00000038421
Gene NameFc receptor-like A
SynonymsFREB, Fcrx, Freb1, mFcrX, mFREB, FCRL1
MMRRC Submission 042525-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4923 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location170917576-170927583 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 170921113 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 154 (F154I)
Ref Sequence ENSEMBL: ENSMUSP00000124859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046322] [ENSMUST00000159149] [ENSMUST00000159171] [ENSMUST00000162136] [ENSMUST00000162887]
Predicted Effect probably damaging
Transcript: ENSMUST00000046322
AA Change: F180I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000036380
Gene: ENSMUSG00000038421
AA Change: F180I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
IG 95 177 5.75e-4 SMART
IG 188 272 1.4e-7 SMART
low complexity region 281 296 N/A INTRINSIC
low complexity region 310 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159149
SMART Domains Protein: ENSMUSP00000125074
Gene: ENSMUSG00000038421

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
IG 66 148 5.75e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159171
AA Change: F179I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124853
Gene: ENSMUSG00000038421
AA Change: F179I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
IG 94 176 5.75e-4 SMART
IG 187 271 1.4e-7 SMART
low complexity region 280 295 N/A INTRINSIC
low complexity region 309 322 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161050
Predicted Effect probably damaging
Transcript: ENSMUST00000162136
AA Change: F154I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124859
Gene: ENSMUSG00000038421
AA Change: F154I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
Pfam:Ig_2 83 150 2.2e-6 PFAM
Pfam:Ig_2 156 215 1e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162887
SMART Domains Protein: ENSMUSP00000124469
Gene: ENSMUSG00000038421

DomainStartEndE-ValueType
Pfam:Ig_2 28 78 1.4e-7 PFAM
Meta Mutation Damage Score 0.422 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to receptors for the Fc fragment of gamma immunoglobulin (IgG). These receptors, referred to as FCGRs, mediate the destruction of IgG-coated antigens and of cells induced by antibodies. This encoded protein is selectively expressed in B cells, and may be involved in their development. This protein may also be involved in the development of lymphomas. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a targeted allele exhibit largely normal T-dependent and T-independent antibody responses with an increase in IgG1 after secondary challenge with sheep red blood cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik C T 3: 108,471,968 probably null Het
5830473C10Rik A G 5: 90,561,299 T23A probably benign Het
Aim2 A G 1: 173,459,806 D124G probably benign Het
Akr1c6 T C 13: 4,454,495 M293T probably damaging Het
Ankhd1 A G 18: 36,589,452 T343A probably damaging Het
Ano2 T C 6: 125,903,055 probably benign Het
Arfgap2 G A 2: 91,273,659 G353R probably damaging Het
Armc3 A G 2: 19,292,980 probably null Het
Armc4 C G 18: 7,181,787 D846H probably damaging Het
Atp11b T C 3: 35,835,379 probably null Het
BC037034 A T 5: 138,262,379 probably benign Het
Brd4 A G 17: 32,199,240 M13T probably benign Het
Btd T A 14: 31,662,087 M10K possibly damaging Het
C1s2 T C 6: 124,625,690 K515E probably benign Het
Cars A T 7: 143,569,850 Y455N probably damaging Het
Ccdc110 A G 8: 45,943,423 S784G probably benign Het
Chic2 A G 5: 75,011,211 probably benign Het
Chka A T 19: 3,892,105 probably null Het
Chrne A G 11: 70,615,275 I420T possibly damaging Het
Clstn1 T C 4: 149,645,029 V747A probably benign Het
Cobll1 A G 2: 65,099,258 S575P possibly damaging Het
Col6a6 A T 9: 105,788,948 L3Q probably damaging Het
Comtd1 A T 14: 21,848,745 probably benign Het
Cpsf2 T C 12: 101,981,984 V13A probably benign Het
Creb3l4 T A 3: 90,242,214 I115L probably benign Het
Cyp2j12 C T 4: 96,102,109 A407T possibly damaging Het
D11Wsu47e C A 11: 113,688,979 T400K probably benign Het
Ddr2 A G 1: 169,997,929 probably null Het
Dennd4c T C 4: 86,807,538 L743P probably damaging Het
Egfl8 T C 17: 34,614,197 T192A probably benign Het
Elf3 A G 1: 135,256,735 probably benign Het
Etv3 T G 3: 87,535,916 L269R possibly damaging Het
Fah C A 7: 84,602,052 probably benign Het
Fam189a1 A G 7: 64,767,691 S322P probably benign Het
Fbll1 C A 11: 35,797,580 L285F probably benign Het
Fnip2 T A 3: 79,489,394 probably null Het
Focad T C 4: 88,196,846 probably benign Het
Gabrr1 T A 4: 33,162,820 I462N possibly damaging Het
Gnptab A G 10: 88,429,623 T366A probably benign Het
Hnrnpu G A 1: 178,331,452 probably benign Het
Il17ra T A 6: 120,477,445 V299E possibly damaging Het
Impg1 G A 9: 80,345,078 Q607* probably null Het
Impg1 T A 9: 80,345,545 E374V probably damaging Het
Itgax C T 7: 128,148,528 L1039F probably benign Het
Kcnk2 A T 1: 189,339,936 V65D probably damaging Het
Kif20b A C 19: 34,941,211 probably null Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lama5 T G 2: 180,184,149 I2372L probably benign Het
Lilrb4a A G 10: 51,492,043 T85A possibly damaging Het
Mapk13 C A 17: 28,778,223 H330N probably benign Het
Mars C A 10: 127,296,680 probably benign Het
Mdga1 C A 17: 29,838,078 R818L probably damaging Het
Mdn1 T A 4: 32,671,608 L476Q possibly damaging Het
Mup21 T C 4: 62,147,965 E178G probably benign Het
Myg1 A G 15: 102,331,853 N38S probably benign Het
Ncam1 A T 9: 49,505,479 D837E probably benign Het
Ncam2 C T 16: 81,589,791 P686L possibly damaging Het
Nck2 T C 1: 43,461,071 probably benign Het
Nfya T C 17: 48,400,535 probably benign Het
Npat A G 9: 53,571,030 K1346R probably damaging Het
Olfr1245 T C 2: 89,575,679 T16A probably damaging Het
Olfr530 G T 7: 140,373,007 T201K probably benign Het
Olfr805 A G 10: 129,722,812 V244A probably benign Het
Pde7b G T 10: 20,413,127 Q325K probably damaging Het
Pla2r1 A T 2: 60,422,712 M1345K probably benign Het
Prkcz T C 4: 155,357,489 D62G probably damaging Het
Pros1 T A 16: 62,903,572 C228S possibly damaging Het
Ptprc A G 1: 138,078,498 M782T possibly damaging Het
Rcn1 T C 2: 105,389,173 D225G probably benign Het
Recql4 G A 15: 76,710,181 R46C probably damaging Het
Rnf220 C T 4: 117,489,600 R205Q possibly damaging Het
Samd13 T C 3: 146,662,747 D11G probably benign Het
Scp2d1 T A 2: 144,824,110 I123K probably benign Het
Skap1 A T 11: 96,754,044 Y311F probably damaging Het
Slc17a2 G A 13: 23,819,095 V243M probably benign Het
Slc2a10 T C 2: 165,514,756 I112T possibly damaging Het
Slc39a2 G A 14: 51,895,254 G218D probably damaging Het
Sos1 T C 17: 80,434,952 N382S probably benign Het
Spam1 C T 6: 24,796,656 T202I probably damaging Het
Tas2r138 T A 6: 40,612,886 Q142L possibly damaging Het
Tec T A 5: 72,782,022 R217* probably null Het
Tmeff2 T A 1: 50,930,645 V90D probably benign Het
Tmem119 T C 5: 113,795,344 Y132C probably damaging Het
Topbp1 A G 9: 103,312,836 I204V probably benign Het
Ttn A T 2: 76,770,888 I17001N probably damaging Het
Vit T A 17: 78,586,841 M224K probably benign Het
Vmn1r179 T G 7: 23,929,066 H227Q possibly damaging Het
Vmn1r84 T C 7: 12,361,816 N305D probably benign Het
Vmn2r61 A G 7: 42,267,096 N378D probably damaging Het
Vmn2r87 A G 10: 130,478,566 Y384H probably damaging Het
Wiz C T 17: 32,361,596 A294T probably benign Het
Xdh C A 17: 73,924,936 V260L possibly damaging Het
Xirp2 A G 2: 67,512,893 K1826R probably benign Het
Zfp445 A C 9: 122,852,293 I861R probably benign Het
Zfp691 T C 4: 119,170,802 T78A probably benign Het
Other mutations in Fcrla
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Fcrla APN 1 170927498 missense probably benign 0.00
IGL01712:Fcrla APN 1 170921623 unclassified probably null
IGL03323:Fcrla APN 1 170927545 utr 5 prime probably benign
R0113:Fcrla UTSW 1 170922299 start codon destroyed probably null 0.66
R1457:Fcrla UTSW 1 170921004 missense probably damaging 1.00
R1917:Fcrla UTSW 1 170927526 nonsense probably null
R4331:Fcrla UTSW 1 170921676 missense possibly damaging 0.74
R4819:Fcrla UTSW 1 170920939 missense probably damaging 0.99
R5000:Fcrla UTSW 1 170922390 missense probably benign 0.03
R5441:Fcrla UTSW 1 170925422 intron probably benign
R5459:Fcrla UTSW 1 170918169 missense possibly damaging 0.68
R6575:Fcrla UTSW 1 170922228 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTGAGTTCTGAAGAGACTCCTC -3'
(R):5'- TGTTCACAGATCCAGAGCCTG -3'

Sequencing Primer
(F):5'- GAGACTCCTCTGACACTCAGTG -3'
(R):5'- TCTAGTCCCTGCCTAGAAGG -3'
Posted On2016-04-15