Incidental Mutation 'R4923:Slc2a10'
ID378750
Institutional Source Beutler Lab
Gene Symbol Slc2a10
Ensembl Gene ENSMUSG00000027661
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 10
SynonymsGlut10
MMRRC Submission 042525-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R4923 (G1)
Quality Score214
Status Validated
Chromosome2
Chromosomal Location165503787-165519917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 165514756 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 112 (I112T)
Ref Sequence ENSEMBL: ENSMUSP00000029196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029196]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029196
AA Change: I112T

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029196
Gene: ENSMUSG00000027661
AA Change: I112T

DomainStartEndE-ValueType
Pfam:Sugar_tr 10 333 1.7e-51 PFAM
Pfam:MFS_1 14 337 1.1e-28 PFAM
Pfam:Sugar_tr 387 508 3.9e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148463
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: This gene encodes a class III facilitative glucose transporter. Mutations in the related gene in human are associated with arterial tortuosity syndrome. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice carrying ENU-induced mutations in this gene display thickening and aberrant vessel wall shape of large and medium size arteries, with significantly increased elastic fiber number and size. Cerebral arteries appear normal with no evidence of tortuosity, stenosis/dilatation or aneurysm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik C T 3: 108,471,968 probably null Het
5830473C10Rik A G 5: 90,561,299 T23A probably benign Het
Aim2 A G 1: 173,459,806 D124G probably benign Het
Akr1c6 T C 13: 4,454,495 M293T probably damaging Het
Ankhd1 A G 18: 36,589,452 T343A probably damaging Het
Ano2 T C 6: 125,903,055 probably benign Het
Arfgap2 G A 2: 91,273,659 G353R probably damaging Het
Armc3 A G 2: 19,292,980 probably null Het
Armc4 C G 18: 7,181,787 D846H probably damaging Het
Atp11b T C 3: 35,835,379 probably null Het
BC037034 A T 5: 138,262,379 probably benign Het
Brd4 A G 17: 32,199,240 M13T probably benign Het
Btd T A 14: 31,662,087 M10K possibly damaging Het
C1s2 T C 6: 124,625,690 K515E probably benign Het
Cars A T 7: 143,569,850 Y455N probably damaging Het
Ccdc110 A G 8: 45,943,423 S784G probably benign Het
Chic2 A G 5: 75,011,211 probably benign Het
Chka A T 19: 3,892,105 probably null Het
Chrne A G 11: 70,615,275 I420T possibly damaging Het
Clstn1 T C 4: 149,645,029 V747A probably benign Het
Cobll1 A G 2: 65,099,258 S575P possibly damaging Het
Col6a6 A T 9: 105,788,948 L3Q probably damaging Het
Comtd1 A T 14: 21,848,745 probably benign Het
Cpsf2 T C 12: 101,981,984 V13A probably benign Het
Creb3l4 T A 3: 90,242,214 I115L probably benign Het
Cyp2j12 C T 4: 96,102,109 A407T possibly damaging Het
D11Wsu47e C A 11: 113,688,979 T400K probably benign Het
Ddr2 A G 1: 169,997,929 probably null Het
Dennd4c T C 4: 86,807,538 L743P probably damaging Het
Egfl8 T C 17: 34,614,197 T192A probably benign Het
Elf3 A G 1: 135,256,735 probably benign Het
Etv3 T G 3: 87,535,916 L269R possibly damaging Het
Fah C A 7: 84,602,052 probably benign Het
Fam189a1 A G 7: 64,767,691 S322P probably benign Het
Fbll1 C A 11: 35,797,580 L285F probably benign Het
Fcrla A T 1: 170,921,113 F154I probably damaging Het
Fnip2 T A 3: 79,489,394 probably null Het
Focad T C 4: 88,196,846 probably benign Het
Gabrr1 T A 4: 33,162,820 I462N possibly damaging Het
Gnptab A G 10: 88,429,623 T366A probably benign Het
Hnrnpu G A 1: 178,331,452 probably benign Het
Il17ra T A 6: 120,477,445 V299E possibly damaging Het
Impg1 G A 9: 80,345,078 Q607* probably null Het
Impg1 T A 9: 80,345,545 E374V probably damaging Het
Itgax C T 7: 128,148,528 L1039F probably benign Het
Kcnk2 A T 1: 189,339,936 V65D probably damaging Het
Kif20b A C 19: 34,941,211 probably null Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lama5 T G 2: 180,184,149 I2372L probably benign Het
Lilrb4a A G 10: 51,492,043 T85A possibly damaging Het
Mapk13 C A 17: 28,778,223 H330N probably benign Het
Mars C A 10: 127,296,680 probably benign Het
Mdga1 C A 17: 29,838,078 R818L probably damaging Het
Mdn1 T A 4: 32,671,608 L476Q possibly damaging Het
Mup21 T C 4: 62,147,965 E178G probably benign Het
Myg1 A G 15: 102,331,853 N38S probably benign Het
Ncam1 A T 9: 49,505,479 D837E probably benign Het
Ncam2 C T 16: 81,589,791 P686L possibly damaging Het
Nck2 T C 1: 43,461,071 probably benign Het
Nfya T C 17: 48,400,535 probably benign Het
Npat A G 9: 53,571,030 K1346R probably damaging Het
Olfr1245 T C 2: 89,575,679 T16A probably damaging Het
Olfr530 G T 7: 140,373,007 T201K probably benign Het
Olfr805 A G 10: 129,722,812 V244A probably benign Het
Pde7b G T 10: 20,413,127 Q325K probably damaging Het
Pla2r1 A T 2: 60,422,712 M1345K probably benign Het
Prkcz T C 4: 155,357,489 D62G probably damaging Het
Pros1 T A 16: 62,903,572 C228S possibly damaging Het
Ptprc A G 1: 138,078,498 M782T possibly damaging Het
Rcn1 T C 2: 105,389,173 D225G probably benign Het
Recql4 G A 15: 76,710,181 R46C probably damaging Het
Rnf220 C T 4: 117,489,600 R205Q possibly damaging Het
Samd13 T C 3: 146,662,747 D11G probably benign Het
Scp2d1 T A 2: 144,824,110 I123K probably benign Het
Skap1 A T 11: 96,754,044 Y311F probably damaging Het
Slc17a2 G A 13: 23,819,095 V243M probably benign Het
Slc39a2 G A 14: 51,895,254 G218D probably damaging Het
Sos1 T C 17: 80,434,952 N382S probably benign Het
Spam1 C T 6: 24,796,656 T202I probably damaging Het
Tas2r138 T A 6: 40,612,886 Q142L possibly damaging Het
Tec T A 5: 72,782,022 R217* probably null Het
Tmeff2 T A 1: 50,930,645 V90D probably benign Het
Tmem119 T C 5: 113,795,344 Y132C probably damaging Het
Topbp1 A G 9: 103,312,836 I204V probably benign Het
Ttn A T 2: 76,770,888 I17001N probably damaging Het
Vit T A 17: 78,586,841 M224K probably benign Het
Vmn1r179 T G 7: 23,929,066 H227Q possibly damaging Het
Vmn1r84 T C 7: 12,361,816 N305D probably benign Het
Vmn2r61 A G 7: 42,267,096 N378D probably damaging Het
Vmn2r87 A G 10: 130,478,566 Y384H probably damaging Het
Wiz C T 17: 32,361,596 A294T probably benign Het
Xdh C A 17: 73,924,936 V260L possibly damaging Het
Xirp2 A G 2: 67,512,893 K1826R probably benign Het
Zfp445 A C 9: 122,852,293 I861R probably benign Het
Zfp691 T C 4: 119,170,802 T78A probably benign Het
Other mutations in Slc2a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Slc2a10 APN 2 165514780 missense probably damaging 1.00
IGL01465:Slc2a10 APN 2 165517677 missense possibly damaging 0.88
IGL02565:Slc2a10 APN 2 165515080 missense probably damaging 0.99
IGL02902:Slc2a10 APN 2 165518222 missense probably benign 0.08
R1453:Slc2a10 UTSW 2 165517650 missense probably damaging 1.00
R1677:Slc2a10 UTSW 2 165515441 missense probably benign 0.04
R1850:Slc2a10 UTSW 2 165515213 missense probably benign 0.00
R1920:Slc2a10 UTSW 2 165514630 missense probably damaging 1.00
R2269:Slc2a10 UTSW 2 165514781 nonsense probably null
R3921:Slc2a10 UTSW 2 165515601 missense probably benign 0.00
R4407:Slc2a10 UTSW 2 165514764 missense probably damaging 1.00
R4575:Slc2a10 UTSW 2 165516321 missense probably damaging 1.00
R4864:Slc2a10 UTSW 2 165514621 missense probably benign 0.13
R4935:Slc2a10 UTSW 2 165517658 missense probably benign 0.05
R4954:Slc2a10 UTSW 2 165514755 missense probably damaging 0.99
R5681:Slc2a10 UTSW 2 165514740 missense probably benign 0.00
R5782:Slc2a10 UTSW 2 165514838 nonsense probably null
R6116:Slc2a10 UTSW 2 165517703 missense probably damaging 1.00
R6713:Slc2a10 UTSW 2 165515208 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCACTCCAGCTGAACTTCGG -3'
(R):5'- AGCCAAACATGTGCCTCCAG -3'

Sequencing Primer
(F):5'- AGCTGAACTTCGGGCTGAG -3'
(R):5'- ATGTGCCTCCAGCCCCAAG -3'
Posted On2016-04-15