Incidental Mutation 'R4923:Lama5'
ID378751
Institutional Source Beutler Lab
Gene Symbol Lama5
Ensembl Gene ENSMUSG00000015647
Gene Namelaminin, alpha 5
Synonyms
MMRRC Submission 042525-MU
Accession Numbers

Ncbi RefSeq: NM_001081171.2; MGI: 105382

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4923 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location180176373-180225859 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 180184149 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 2372 (I2372L)
Ref Sequence ENSEMBL: ENSMUSP00000015791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015791]
PDB Structure
LAMININ ALPHA5 CHAIN N-TERMINAL FRAGMENT [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000015791
AA Change: I2372L

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000015791
Gene: ENSMUSG00000015647
AA Change: I2372L

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
LamNT 44 303 1.06e-132 SMART
EGF_Lam 305 361 4.35e-6 SMART
EGF_Lam 364 431 5.78e-11 SMART
EGF_Lam 434 476 1.32e-5 SMART
EGF_Lam 500 544 8.63e-10 SMART
EGF_Lam 547 590 1.16e-10 SMART
EGF_Lam 593 635 4.63e-10 SMART
EGF_Lam 638 680 6.25e-7 SMART
EGF_Lam 683 726 3.1e-11 SMART
EGF_Lam 730 779 2.99e-4 SMART
EGF_Lam 782 831 4.66e-6 SMART
EGF_Lam 834 878 3.48e-5 SMART
low complexity region 1261 1273 N/A INTRINSIC
EGF_Lam 1443 1486 7.01e-10 SMART
EGF_like 1489 1530 3.64e-1 SMART
EGF_Lam 1533 1579 8.56e-14 SMART
EGF_Lam 1582 1630 1.86e-14 SMART
LamB 1689 1819 5.86e-61 SMART
EGF_like 1818 1862 2.74e0 SMART
EGF_Lam 1865 1912 3.32e-11 SMART
EGF_Lam 1915 1968 1.61e-9 SMART
EGF_Lam 1971 2022 6.39e-13 SMART
EGF_Lam 2025 2069 1.94e-12 SMART
EGF_Lam 2072 2116 1.35e-11 SMART
EGF_like 2103 2145 3.1e1 SMART
EGF_Lam 2119 2166 1.18e-2 SMART
Pfam:Laminin_I 2189 2453 1.7e-65 PFAM
low complexity region 2532 2548 N/A INTRINSIC
low complexity region 2557 2569 N/A INTRINSIC
low complexity region 2632 2641 N/A INTRINSIC
low complexity region 2663 2676 N/A INTRINSIC
LamG 2760 2912 3.97e-8 SMART
LamG 2966 3103 1.78e-10 SMART
LamG 3149 3274 1.11e-20 SMART
LamG 3359 3497 4.05e-23 SMART
LamG 3539 3670 3e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185089
Meta Mutation Damage Score 0.1188 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 98% (107/109)
MGI Phenotype Strain: 3624772; 1934917
Lethality: E1-E17
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the vertebrate laminin alpha chains. Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. The protein encoded by this gene is the alpha-5 subunit of of laminin-10 (laminin-511), laminin-11 (laminin-521) and laminin-15 (laminin-523). [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit disrupted basal laminae leading to exencephaly, syndactyly, placentopathy, kidney defects, abnormal lobar septation with absence of a visceral pleural membrane, and lethality in late gestation. [provided by MGI curators]
Allele List at MGI

All alleles(49) : Targeted(5) Gene trapped(44)

Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik C T 3: 108,471,968 probably null Het
5830473C10Rik A G 5: 90,561,299 T23A probably benign Het
Aim2 A G 1: 173,459,806 D124G probably benign Het
Akr1c6 T C 13: 4,454,495 M293T probably damaging Het
Ankhd1 A G 18: 36,589,452 T343A probably damaging Het
Ano2 T C 6: 125,903,055 probably benign Het
Arfgap2 G A 2: 91,273,659 G353R probably damaging Het
Armc3 A G 2: 19,292,980 probably null Het
Armc4 C G 18: 7,181,787 D846H probably damaging Het
Atp11b T C 3: 35,835,379 probably null Het
BC037034 A T 5: 138,262,379 probably benign Het
Brd4 A G 17: 32,199,240 M13T probably benign Het
Btd T A 14: 31,662,087 M10K possibly damaging Het
C1s2 T C 6: 124,625,690 K515E probably benign Het
Cars A T 7: 143,569,850 Y455N probably damaging Het
Ccdc110 A G 8: 45,943,423 S784G probably benign Het
Chic2 A G 5: 75,011,211 probably benign Het
Chka A T 19: 3,892,105 probably null Het
Chrne A G 11: 70,615,275 I420T possibly damaging Het
Clstn1 T C 4: 149,645,029 V747A probably benign Het
Cobll1 A G 2: 65,099,258 S575P possibly damaging Het
Col6a6 A T 9: 105,788,948 L3Q probably damaging Het
Comtd1 A T 14: 21,848,745 probably benign Het
Cpsf2 T C 12: 101,981,984 V13A probably benign Het
Creb3l4 T A 3: 90,242,214 I115L probably benign Het
Cyp2j12 C T 4: 96,102,109 A407T possibly damaging Het
D11Wsu47e C A 11: 113,688,979 T400K probably benign Het
Ddr2 A G 1: 169,997,929 probably null Het
Dennd4c T C 4: 86,807,538 L743P probably damaging Het
Egfl8 T C 17: 34,614,197 T192A probably benign Het
Elf3 A G 1: 135,256,735 probably benign Het
Etv3 T G 3: 87,535,916 L269R possibly damaging Het
Fah C A 7: 84,602,052 probably benign Het
Fam189a1 A G 7: 64,767,691 S322P probably benign Het
Fbll1 C A 11: 35,797,580 L285F probably benign Het
Fcrla A T 1: 170,921,113 F154I probably damaging Het
Fnip2 T A 3: 79,489,394 probably null Het
Focad T C 4: 88,196,846 probably benign Het
Gabrr1 T A 4: 33,162,820 I462N possibly damaging Het
Gnptab A G 10: 88,429,623 T366A probably benign Het
Hnrnpu G A 1: 178,331,452 probably benign Het
Il17ra T A 6: 120,477,445 V299E possibly damaging Het
Impg1 G A 9: 80,345,078 Q607* probably null Het
Impg1 T A 9: 80,345,545 E374V probably damaging Het
Itgax C T 7: 128,148,528 L1039F probably benign Het
Kcnk2 A T 1: 189,339,936 V65D probably damaging Het
Kif20b A C 19: 34,941,211 probably null Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lilrb4a A G 10: 51,492,043 T85A possibly damaging Het
Mapk13 C A 17: 28,778,223 H330N probably benign Het
Mars C A 10: 127,296,680 probably benign Het
Mdga1 C A 17: 29,838,078 R818L probably damaging Het
Mdn1 T A 4: 32,671,608 L476Q possibly damaging Het
Mup21 T C 4: 62,147,965 E178G probably benign Het
Myg1 A G 15: 102,331,853 N38S probably benign Het
Ncam1 A T 9: 49,505,479 D837E probably benign Het
Ncam2 C T 16: 81,589,791 P686L possibly damaging Het
Nck2 T C 1: 43,461,071 probably benign Het
Nfya T C 17: 48,400,535 probably benign Het
Npat A G 9: 53,571,030 K1346R probably damaging Het
Olfr1245 T C 2: 89,575,679 T16A probably damaging Het
Olfr530 G T 7: 140,373,007 T201K probably benign Het
Olfr805 A G 10: 129,722,812 V244A probably benign Het
Pde7b G T 10: 20,413,127 Q325K probably damaging Het
Pla2r1 A T 2: 60,422,712 M1345K probably benign Het
Prkcz T C 4: 155,357,489 D62G probably damaging Het
Pros1 T A 16: 62,903,572 C228S possibly damaging Het
Ptprc A G 1: 138,078,498 M782T possibly damaging Het
Rcn1 T C 2: 105,389,173 D225G probably benign Het
Recql4 G A 15: 76,710,181 R46C probably damaging Het
Rnf220 C T 4: 117,489,600 R205Q possibly damaging Het
Samd13 T C 3: 146,662,747 D11G probably benign Het
Scp2d1 T A 2: 144,824,110 I123K probably benign Het
Skap1 A T 11: 96,754,044 Y311F probably damaging Het
Slc17a2 G A 13: 23,819,095 V243M probably benign Het
Slc2a10 T C 2: 165,514,756 I112T possibly damaging Het
Slc39a2 G A 14: 51,895,254 G218D probably damaging Het
Sos1 T C 17: 80,434,952 N382S probably benign Het
Spam1 C T 6: 24,796,656 T202I probably damaging Het
Tas2r138 T A 6: 40,612,886 Q142L possibly damaging Het
Tec T A 5: 72,782,022 R217* probably null Het
Tmeff2 T A 1: 50,930,645 V90D probably benign Het
Tmem119 T C 5: 113,795,344 Y132C probably damaging Het
Topbp1 A G 9: 103,312,836 I204V probably benign Het
Ttn A T 2: 76,770,888 I17001N probably damaging Het
Vit T A 17: 78,586,841 M224K probably benign Het
Vmn1r179 T G 7: 23,929,066 H227Q possibly damaging Het
Vmn1r84 T C 7: 12,361,816 N305D probably benign Het
Vmn2r61 A G 7: 42,267,096 N378D probably damaging Het
Vmn2r87 A G 10: 130,478,566 Y384H probably damaging Het
Wiz C T 17: 32,361,596 A294T probably benign Het
Xdh C A 17: 73,924,936 V260L possibly damaging Het
Xirp2 A G 2: 67,512,893 K1826R probably benign Het
Zfp445 A C 9: 122,852,293 I861R probably benign Het
Zfp691 T C 4: 119,170,802 T78A probably benign Het
Other mutations in Lama5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Lama5 APN 2 180176543 unclassified probably benign
IGL01370:Lama5 APN 2 180197400 missense possibly damaging 0.87
IGL01474:Lama5 APN 2 180196570 missense probably damaging 1.00
IGL01614:Lama5 APN 2 180180864 missense probably damaging 1.00
IGL01941:Lama5 APN 2 180192392 missense possibly damaging 0.71
IGL01953:Lama5 APN 2 180190704 missense probably damaging 0.97
IGL02093:Lama5 APN 2 180188587 missense probably damaging 1.00
IGL02197:Lama5 APN 2 180207219 missense possibly damaging 0.82
IGL02308:Lama5 APN 2 180190327 splice site probably benign
IGL02314:Lama5 APN 2 180194482 splice site probably benign
IGL02317:Lama5 APN 2 180191319 missense probably damaging 1.00
IGL02354:Lama5 APN 2 180193884 nonsense probably null
IGL02361:Lama5 APN 2 180193884 nonsense probably null
IGL02557:Lama5 APN 2 180190932 nonsense probably null
IGL03026:Lama5 APN 2 180195967 missense probably benign 0.34
IGL03160:Lama5 APN 2 180180335 missense probably damaging 1.00
IGL03238:Lama5 APN 2 180188574 missense probably benign
IGL03390:Lama5 APN 2 180207218 missense probably damaging 1.00
Salty UTSW 2 180181651 missense possibly damaging 0.84
PIT4378001:Lama5 UTSW 2 180189445 missense possibly damaging 0.89
R0003:Lama5 UTSW 2 180178079 unclassified probably null
R0056:Lama5 UTSW 2 180187106 intron probably benign
R0147:Lama5 UTSW 2 180190406 missense probably benign
R0148:Lama5 UTSW 2 180190406 missense probably benign
R0310:Lama5 UTSW 2 180181566 splice site probably benign
R0326:Lama5 UTSW 2 180182426 missense possibly damaging 0.90
R0368:Lama5 UTSW 2 180181230 nonsense probably null
R0479:Lama5 UTSW 2 180184457 missense probably benign 0.03
R0490:Lama5 UTSW 2 180180169 missense possibly damaging 0.90
R0636:Lama5 UTSW 2 180189331 critical splice donor site probably null
R0704:Lama5 UTSW 2 180179484 missense possibly damaging 0.84
R0733:Lama5 UTSW 2 180180718 missense possibly damaging 0.83
R1017:Lama5 UTSW 2 180195420 missense probably damaging 1.00
R1078:Lama5 UTSW 2 180179764 unclassified probably benign
R1294:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1423:Lama5 UTSW 2 180195641 missense probably damaging 1.00
R1438:Lama5 UTSW 2 180182800 missense probably benign 0.01
R1447:Lama5 UTSW 2 180185878 missense probably damaging 0.99
R1540:Lama5 UTSW 2 180180151 missense probably benign
R1601:Lama5 UTSW 2 180197745 missense probably damaging 1.00
R1624:Lama5 UTSW 2 180206758 missense probably benign 0.02
R1674:Lama5 UTSW 2 180201987 missense probably benign 0.00
R1687:Lama5 UTSW 2 180194066 missense probably benign 0.00
R1696:Lama5 UTSW 2 180202486 missense probably damaging 1.00
R1701:Lama5 UTSW 2 180221369 missense probably damaging 1.00
R1778:Lama5 UTSW 2 180195481 splice site probably benign
R1936:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1939:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1940:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1953:Lama5 UTSW 2 180190747 missense possibly damaging 0.94
R1966:Lama5 UTSW 2 180188352 missense probably damaging 1.00
R2024:Lama5 UTSW 2 180179130 missense probably benign 0.00
R2079:Lama5 UTSW 2 180225508 missense possibly damaging 0.68
R2115:Lama5 UTSW 2 180186885 missense probably damaging 1.00
R2173:Lama5 UTSW 2 180196242 missense probably benign 0.00
R2272:Lama5 UTSW 2 180178603 missense possibly damaging 0.93
R2357:Lama5 UTSW 2 180180097 missense probably benign 0.01
R2860:Lama5 UTSW 2 180187247 missense probably benign 0.00
R2861:Lama5 UTSW 2 180187247 missense probably benign 0.00
R2939:Lama5 UTSW 2 180198954 missense probably damaging 1.00
R3053:Lama5 UTSW 2 180183067 missense probably damaging 0.99
R3430:Lama5 UTSW 2 180196317 missense probably benign 0.00
R3752:Lama5 UTSW 2 180187222 missense probably damaging 1.00
R3782:Lama5 UTSW 2 180194563 missense possibly damaging 0.57
R3901:Lama5 UTSW 2 180182351 splice site probably benign
R4248:Lama5 UTSW 2 180180427 missense possibly damaging 0.84
R4626:Lama5 UTSW 2 180184460 missense probably damaging 0.98
R4638:Lama5 UTSW 2 180190413 missense possibly damaging 0.89
R4669:Lama5 UTSW 2 180180637 missense probably damaging 1.00
R4673:Lama5 UTSW 2 180199266 missense probably damaging 1.00
R4677:Lama5 UTSW 2 180179366 missense possibly damaging 0.69
R4701:Lama5 UTSW 2 180191696 missense probably damaging 1.00
R4774:Lama5 UTSW 2 180185941 missense probably damaging 1.00
R4880:Lama5 UTSW 2 180177068 unclassified probably benign
R4960:Lama5 UTSW 2 180208252 critical splice donor site probably null
R4983:Lama5 UTSW 2 180193449 missense probably benign 0.13
R5061:Lama5 UTSW 2 180198786 nonsense probably null
R5080:Lama5 UTSW 2 180207200 nonsense probably null
R5135:Lama5 UTSW 2 180202220 missense possibly damaging 0.89
R5206:Lama5 UTSW 2 180191304 missense probably damaging 1.00
R5296:Lama5 UTSW 2 180193801 missense probably damaging 1.00
R5319:Lama5 UTSW 2 180181118 missense probably damaging 1.00
R5355:Lama5 UTSW 2 180181651 missense possibly damaging 0.84
R5388:Lama5 UTSW 2 180190746 missense possibly damaging 0.83
R5528:Lama5 UTSW 2 180194563 missense probably benign 0.21
R5536:Lama5 UTSW 2 180189349 missense probably damaging 0.99
R5658:Lama5 UTSW 2 180208276 nonsense probably null
R5823:Lama5 UTSW 2 180192492 missense probably benign 0.04
R5885:Lama5 UTSW 2 180201831 missense probably damaging 1.00
R5889:Lama5 UTSW 2 180193674 intron probably benign
R5912:Lama5 UTSW 2 180195475 missense probably damaging 1.00
R5955:Lama5 UTSW 2 180197474 missense probably damaging 1.00
R6015:Lama5 UTSW 2 180185392 missense probably benign 0.36
R6037:Lama5 UTSW 2 180207013 missense probably damaging 1.00
R6037:Lama5 UTSW 2 180207013 missense probably damaging 1.00
R6191:Lama5 UTSW 2 180180611 missense probably damaging 0.98
R6191:Lama5 UTSW 2 180185959 missense probably damaging 1.00
R6359:Lama5 UTSW 2 180195982 missense probably benign 0.01
R6385:Lama5 UTSW 2 180196533 missense probably damaging 1.00
R6406:Lama5 UTSW 2 180197464 nonsense probably null
R6552:Lama5 UTSW 2 180181154 missense probably damaging 0.98
R6632:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6633:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6645:Lama5 UTSW 2 180179670 missense probably damaging 1.00
R6731:Lama5 UTSW 2 180188574 missense probably benign 0.09
R6744:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6798:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6799:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6801:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6851:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6869:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6881:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6882:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6884:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R7022:Lama5 UTSW 2 180180731 missense probably damaging 1.00
R7204:Lama5 UTSW 2 180202177 missense probably damaging 1.00
R7207:Lama5 UTSW 2 180207084 missense probably damaging 0.98
R7282:Lama5 UTSW 2 180201795 missense probably damaging 1.00
X0065:Lama5 UTSW 2 180181731 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CCTGGGTCTGAGAGAACATG -3'
(R):5'- TGCTTCTGAGGTGGACTAGAC -3'

Sequencing Primer
(F):5'- TTGACAGAAGACCAGGGCCTG -3'
(R):5'- TGGACTAGACCGGTGCTG -3'
Posted On2016-04-15