Incidental Mutation 'R4923:Itgax'
ID378783
Institutional Source Beutler Lab
Gene Symbol Itgax
Ensembl Gene ENSMUSG00000030789
Gene Nameintegrin alpha X
SynonymsCd11c, CD11C (p150) alpha polypeptide
MMRRC Submission 042525-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R4923 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location128129547-128150657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 128148528 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 1039 (L1039F)
Ref Sequence ENSEMBL: ENSMUSP00000033053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033053]
Predicted Effect probably benign
Transcript: ENSMUST00000033053
AA Change: L1039F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033053
Gene: ENSMUSG00000030789
AA Change: L1039F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Int_alpha 33 83 1.28e1 SMART
VWA 150 331 8.36e-43 SMART
Int_alpha 402 451 3.67e-3 SMART
Int_alpha 455 512 1.29e-7 SMART
Int_alpha 518 574 5.72e-14 SMART
Int_alpha 581 635 1.55e-1 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 6.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206396
Meta Mutation Damage Score 0.0492 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha X chain protein. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as inactivated-C3b (iC3b) receptor 4 (CR4). The alpha X beta 2 complex seems to overlap the properties of the alpha M beta 2 integrin in the adherence of neutrophils and monocytes to stimulated endothelium cells, and in the phagocytosis of complement coated particles. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, decreased susceptibility to experimental autoimmune encephalomyelitis (EAE), increased T cell proliferation, and an abnormal pattern of cytokine production during EAE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik C T 3: 108,471,968 probably null Het
5830473C10Rik A G 5: 90,561,299 T23A probably benign Het
Aim2 A G 1: 173,459,806 D124G probably benign Het
Akr1c6 T C 13: 4,454,495 M293T probably damaging Het
Ankhd1 A G 18: 36,589,452 T343A probably damaging Het
Ano2 T C 6: 125,903,055 probably benign Het
Arfgap2 G A 2: 91,273,659 G353R probably damaging Het
Armc3 A G 2: 19,292,980 probably null Het
Armc4 C G 18: 7,181,787 D846H probably damaging Het
Atp11b T C 3: 35,835,379 probably null Het
BC037034 A T 5: 138,262,379 probably benign Het
Brd4 A G 17: 32,199,240 M13T probably benign Het
Btd T A 14: 31,662,087 M10K possibly damaging Het
C1s2 T C 6: 124,625,690 K515E probably benign Het
Cars A T 7: 143,569,850 Y455N probably damaging Het
Ccdc110 A G 8: 45,943,423 S784G probably benign Het
Chic2 A G 5: 75,011,211 probably benign Het
Chka A T 19: 3,892,105 probably null Het
Chrne A G 11: 70,615,275 I420T possibly damaging Het
Clstn1 T C 4: 149,645,029 V747A probably benign Het
Cobll1 A G 2: 65,099,258 S575P possibly damaging Het
Col6a6 A T 9: 105,788,948 L3Q probably damaging Het
Comtd1 A T 14: 21,848,745 probably benign Het
Cpsf2 T C 12: 101,981,984 V13A probably benign Het
Creb3l4 T A 3: 90,242,214 I115L probably benign Het
Cyp2j12 C T 4: 96,102,109 A407T possibly damaging Het
D11Wsu47e C A 11: 113,688,979 T400K probably benign Het
Ddr2 A G 1: 169,997,929 probably null Het
Dennd4c T C 4: 86,807,538 L743P probably damaging Het
Egfl8 T C 17: 34,614,197 T192A probably benign Het
Elf3 A G 1: 135,256,735 probably benign Het
Etv3 T G 3: 87,535,916 L269R possibly damaging Het
Fah C A 7: 84,602,052 probably benign Het
Fam189a1 A G 7: 64,767,691 S322P probably benign Het
Fbll1 C A 11: 35,797,580 L285F probably benign Het
Fcrla A T 1: 170,921,113 F154I probably damaging Het
Fnip2 T A 3: 79,489,394 probably null Het
Focad T C 4: 88,196,846 probably benign Het
Gabrr1 T A 4: 33,162,820 I462N possibly damaging Het
Gnptab A G 10: 88,429,623 T366A probably benign Het
Hnrnpu G A 1: 178,331,452 probably benign Het
Il17ra T A 6: 120,477,445 V299E possibly damaging Het
Impg1 G A 9: 80,345,078 Q607* probably null Het
Impg1 T A 9: 80,345,545 E374V probably damaging Het
Kcnk2 A T 1: 189,339,936 V65D probably damaging Het
Kif20b A C 19: 34,941,211 probably null Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lama5 T G 2: 180,184,149 I2372L probably benign Het
Lilrb4a A G 10: 51,492,043 T85A possibly damaging Het
Mapk13 C A 17: 28,778,223 H330N probably benign Het
Mars C A 10: 127,296,680 probably benign Het
Mdga1 C A 17: 29,838,078 R818L probably damaging Het
Mdn1 T A 4: 32,671,608 L476Q possibly damaging Het
Mup21 T C 4: 62,147,965 E178G probably benign Het
Myg1 A G 15: 102,331,853 N38S probably benign Het
Ncam1 A T 9: 49,505,479 D837E probably benign Het
Ncam2 C T 16: 81,589,791 P686L possibly damaging Het
Nck2 T C 1: 43,461,071 probably benign Het
Nfya T C 17: 48,400,535 probably benign Het
Npat A G 9: 53,571,030 K1346R probably damaging Het
Olfr1245 T C 2: 89,575,679 T16A probably damaging Het
Olfr530 G T 7: 140,373,007 T201K probably benign Het
Olfr805 A G 10: 129,722,812 V244A probably benign Het
Pde7b G T 10: 20,413,127 Q325K probably damaging Het
Pla2r1 A T 2: 60,422,712 M1345K probably benign Het
Prkcz T C 4: 155,357,489 D62G probably damaging Het
Pros1 T A 16: 62,903,572 C228S possibly damaging Het
Ptprc A G 1: 138,078,498 M782T possibly damaging Het
Rcn1 T C 2: 105,389,173 D225G probably benign Het
Recql4 G A 15: 76,710,181 R46C probably damaging Het
Rnf220 C T 4: 117,489,600 R205Q possibly damaging Het
Samd13 T C 3: 146,662,747 D11G probably benign Het
Scp2d1 T A 2: 144,824,110 I123K probably benign Het
Skap1 A T 11: 96,754,044 Y311F probably damaging Het
Slc17a2 G A 13: 23,819,095 V243M probably benign Het
Slc2a10 T C 2: 165,514,756 I112T possibly damaging Het
Slc39a2 G A 14: 51,895,254 G218D probably damaging Het
Sos1 T C 17: 80,434,952 N382S probably benign Het
Spam1 C T 6: 24,796,656 T202I probably damaging Het
Tas2r138 T A 6: 40,612,886 Q142L possibly damaging Het
Tec T A 5: 72,782,022 R217* probably null Het
Tmeff2 T A 1: 50,930,645 V90D probably benign Het
Tmem119 T C 5: 113,795,344 Y132C probably damaging Het
Topbp1 A G 9: 103,312,836 I204V probably benign Het
Ttn A T 2: 76,770,888 I17001N probably damaging Het
Vit T A 17: 78,586,841 M224K probably benign Het
Vmn1r179 T G 7: 23,929,066 H227Q possibly damaging Het
Vmn1r84 T C 7: 12,361,816 N305D probably benign Het
Vmn2r61 A G 7: 42,267,096 N378D probably damaging Het
Vmn2r87 A G 10: 130,478,566 Y384H probably damaging Het
Wiz C T 17: 32,361,596 A294T probably benign Het
Xdh C A 17: 73,924,936 V260L possibly damaging Het
Xirp2 A G 2: 67,512,893 K1826R probably benign Het
Zfp445 A C 9: 122,852,293 I861R probably benign Het
Zfp691 T C 4: 119,170,802 T78A probably benign Het
Other mutations in Itgax
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Itgax APN 7 128135326 missense probably damaging 1.00
IGL00325:Itgax APN 7 128148309 missense possibly damaging 0.69
IGL01155:Itgax APN 7 128145035 missense probably benign 0.00
IGL01461:Itgax APN 7 128135018 missense probably damaging 1.00
IGL01508:Itgax APN 7 128144818 missense probably damaging 1.00
IGL01549:Itgax APN 7 128131206 splice site probably null
IGL01864:Itgax APN 7 128133763 missense probably benign 0.00
IGL02094:Itgax APN 7 128131473 missense probably damaging 1.00
IGL02364:Itgax APN 7 128139982 missense possibly damaging 0.89
IGL02969:Itgax APN 7 128149123 missense probably benign
IGL03406:Itgax APN 7 128149198 missense possibly damaging 0.93
Adendritic UTSW 7 128148572 nonsense probably null
PIT4651001:Itgax UTSW 7 128149110 missense probably benign 0.11
R0366:Itgax UTSW 7 128149089 splice site probably benign
R0763:Itgax UTSW 7 128147940 splice site probably benign
R1072:Itgax UTSW 7 128150144 missense probably damaging 0.96
R1659:Itgax UTSW 7 128130891 missense probably benign 0.15
R2019:Itgax UTSW 7 128148526 missense probably benign
R2418:Itgax UTSW 7 128142333 missense probably damaging 0.98
R3027:Itgax UTSW 7 128148572 nonsense probably null
R3846:Itgax UTSW 7 128133767 missense probably damaging 1.00
R3938:Itgax UTSW 7 128136273 missense possibly damaging 0.73
R4021:Itgax UTSW 7 128133139 critical splice donor site probably null
R4027:Itgax UTSW 7 128141266 missense possibly damaging 0.75
R4163:Itgax UTSW 7 128144700 missense probably benign 0.00
R5259:Itgax UTSW 7 128148278 missense probably damaging 0.99
R5333:Itgax UTSW 7 128142283 missense probably damaging 1.00
R5347:Itgax UTSW 7 128141302 missense probably benign 0.08
R5679:Itgax UTSW 7 128134990 missense probably benign 0.00
R5725:Itgax UTSW 7 128147861 missense possibly damaging 0.63
R5733:Itgax UTSW 7 128140475 missense probably damaging 0.99
R5750:Itgax UTSW 7 128144706 missense probably benign 0.32
R5964:Itgax UTSW 7 128140447 missense probably damaging 1.00
R6004:Itgax UTSW 7 128131452 missense probably damaging 0.96
R6168:Itgax UTSW 7 128133097 missense probably damaging 0.99
R6212:Itgax UTSW 7 128130332 missense possibly damaging 0.52
R6212:Itgax UTSW 7 128147853 missense probably benign 0.16
R6480:Itgax UTSW 7 128148599 missense probably benign 0.12
R6484:Itgax UTSW 7 128133718 missense probably benign 0.13
R6796:Itgax UTSW 7 128135064 missense probably damaging 1.00
R6844:Itgax UTSW 7 128147934 splice site probably null
R7287:Itgax UTSW 7 128148505 missense probably damaging 1.00
R7365:Itgax UTSW 7 128135309 missense probably damaging 1.00
R7421:Itgax UTSW 7 128140432 missense probably damaging 1.00
X0061:Itgax UTSW 7 128129607 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CGTGCTGGTGAGGAAAACAC -3'
(R):5'- GAGCTCAGGGTTCAAAGACTG -3'

Sequencing Primer
(F):5'- GAGGACCTGAAAACTCACTTGCTG -3'
(R):5'- TCAGGGTTCAAAGACTGCCCTG -3'
Posted On2016-04-15