Incidental Mutation 'R4926:Ccdc171'
ID379010
Institutional Source Beutler Lab
Gene Symbol Ccdc171
Ensembl Gene ENSMUSG00000052407
Gene Namecoiled-coil domain containing 171
Synonyms4930473A06Rik, 4930418J05Rik, A330015D16Rik
MMRRC Submission 042527-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R4926 (G1)
Quality Score137
Status Validated
Chromosome4
Chromosomal Location83525545-83864670 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 83558592 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053414] [ENSMUST00000125077] [ENSMUST00000126429] [ENSMUST00000231339]
Predicted Effect probably benign
Transcript: ENSMUST00000053414
SMART Domains Protein: ENSMUSP00000056520
Gene: ENSMUSG00000052407

DomainStartEndE-ValueType
coiled coil region 48 298 N/A INTRINSIC
coiled coil region 325 393 N/A INTRINSIC
coiled coil region 453 527 N/A INTRINSIC
coiled coil region 599 628 N/A INTRINSIC
coiled coil region 653 712 N/A INTRINSIC
low complexity region 728 743 N/A INTRINSIC
low complexity region 783 797 N/A INTRINSIC
coiled coil region 981 1145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107202
SMART Domains Protein: ENSMUSP00000102820
Gene: ENSMUSG00000052407

DomainStartEndE-ValueType
coiled coil region 21 125 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125077
SMART Domains Protein: ENSMUSP00000116486
Gene: ENSMUSG00000052407

DomainStartEndE-ValueType
coiled coil region 48 298 N/A INTRINSIC
coiled coil region 325 393 N/A INTRINSIC
coiled coil region 453 535 N/A INTRINSIC
coiled coil region 607 636 N/A INTRINSIC
coiled coil region 661 720 N/A INTRINSIC
low complexity region 736 751 N/A INTRINSIC
low complexity region 791 805 N/A INTRINSIC
coiled coil region 989 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126429
SMART Domains Protein: ENSMUSP00000138195
Gene: ENSMUSG00000052407

DomainStartEndE-ValueType
coiled coil region 48 91 N/A INTRINSIC
low complexity region 93 117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231339
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 99% (87/88)
MGI Phenotype PHENOTYPE: Mice that either homozygous or heterozygous for an ENU-induced single point mutation exhibit decreased mature B cell number, decreased IgD level, and increased IgM level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A T 9: 108,395,299 D136V probably damaging Het
Ankrd17 G A 5: 90,300,032 R217W probably damaging Het
Ankrd23 A T 1: 36,531,987 H102Q probably damaging Het
Arfip2 G T 7: 105,637,944 R138S probably damaging Het
Arhgap27 A T 11: 103,339,123 probably null Het
Atg2a T C 19: 6,257,533 L1499P probably damaging Het
Bnc2 A G 4: 84,276,179 S110P probably damaging Het
Ccdc7a A G 8: 128,980,054 probably benign Het
Chd5 T C 4: 152,383,311 S1689P probably benign Het
Corin A G 5: 72,372,182 C212R probably damaging Het
Cyp2c65 A G 19: 39,061,153 I42V probably benign Het
Cyp3a25 G A 5: 145,991,456 R260C probably damaging Het
Dock6 T C 9: 21,845,791 Y116C probably damaging Het
Eif3a A G 19: 60,763,218 probably benign Het
Epop T C 11: 97,628,317 D322G probably damaging Het
Eps8l3 T A 3: 107,890,688 probably benign Het
Exph5 T C 9: 53,376,625 S1669P possibly damaging Het
Faah A T 4: 115,999,626 probably benign Het
Fanca A G 8: 123,303,985 C453R probably benign Het
Fcgbp T A 7: 28,086,235 C366S probably damaging Het
Fmn2 A G 1: 174,502,415 T124A unknown Het
Foxi3 C T 6: 70,957,012 S161L probably damaging Het
Foxo3 A T 10: 42,197,024 V499E probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gbgt1 T C 2: 28,503,170 V90A probably damaging Het
Gm839 A C 6: 89,212,599 noncoding transcript Het
Gtf3c2 T C 5: 31,169,123 E348G possibly damaging Het
Hnrnpm G T 17: 33,649,801 R551S probably damaging Het
Hspa1l A G 17: 34,978,223 T413A possibly damaging Het
Hspg2 T C 4: 137,542,530 Y2297H probably damaging Het
Ighv1-81 T A 12: 115,920,473 I53L probably benign Het
Kcnj11 C T 7: 46,099,120 V260I probably benign Het
Krt84 A G 15: 101,530,254 V266A probably benign Het
Lgals3bp T C 11: 118,393,955 Y266C probably damaging Het
Lrrc41 T C 4: 116,089,324 V412A possibly damaging Het
Map4k4 A T 1: 40,017,225 E1023D probably damaging Het
Mark3 T A 12: 111,618,324 L118* probably null Het
Mrgpra9 T A 7: 47,235,011 T303S possibly damaging Het
Mterf4 T C 1: 93,304,925 E68G probably benign Het
Nckap5 A C 1: 126,528,641 probably benign Het
Nox3 T A 17: 3,669,894 T339S probably damaging Het
Nrip2 A C 6: 128,408,374 H256P probably benign Het
Oas1d T C 5: 120,915,768 V97A probably benign Het
Obox2 T A 7: 15,397,177 probably null Het
Olfr979 T C 9: 40,001,023 probably null Het
Opa1 T C 16: 29,648,973 F989S possibly damaging Het
Padi1 T A 4: 140,824,847 I429F probably damaging Het
Paics A G 5: 76,961,204 D163G probably damaging Het
Pik3c2b G T 1: 133,099,626 E1288* probably null Het
Prdm16 A T 4: 154,341,552 V593D possibly damaging Het
Prpf39 A G 12: 65,044,056 I165M possibly damaging Het
Pth2r A G 1: 65,321,984 T26A probably benign Het
Ptpn21 T C 12: 98,715,195 probably null Het
Rab44 C T 17: 29,139,555 A239V probably benign Het
Rtcb T C 10: 85,955,736 N52S probably benign Het
Sapcd2 T A 2: 25,373,566 probably null Het
Scaf11 T C 15: 96,418,242 E1147G possibly damaging Het
Selenoo T C 15: 89,099,678 Y595H probably damaging Het
Slc2a5 G T 4: 150,120,742 E3* probably null Het
Snw1 A G 12: 87,452,658 V391A probably benign Het
Sorbs2 A G 8: 45,796,217 K755R probably benign Het
Sorbs3 G T 14: 70,186,945 P513T probably damaging Het
Sowaha T A 11: 53,479,510 E133V possibly damaging Het
Srsf5 T C 12: 80,947,301 probably benign Het
St8sia5 T A 18: 77,254,782 M396K possibly damaging Het
Tcp11l1 T C 2: 104,681,785 I501V probably benign Het
Tert A G 13: 73,648,389 K1080E possibly damaging Het
Tescl T A 7: 24,333,898 M1L possibly damaging Het
Thop1 T A 10: 81,073,367 probably null Het
Tmtc4 T C 14: 122,973,206 H80R probably damaging Het
Toe1 C T 4: 116,804,532 S480N probably damaging Het
Trap1 C A 16: 4,045,488 V557F probably benign Het
Trim30d T C 7: 104,483,357 E91G probably benign Het
Ttf1 C T 2: 29,064,656 H11Y possibly damaging Het
Ttll8 C A 15: 88,914,165 G789V probably damaging Het
Ulk4 A G 9: 121,258,732 F298S probably benign Het
Wwc1 C T 11: 35,889,400 A243T probably benign Het
Zfp248 A C 6: 118,429,826 H267Q possibly damaging Het
Zfyve26 T A 12: 79,275,011 M945L probably benign Het
Zufsp T C 10: 33,949,438 D16G probably damaging Het
Other mutations in Ccdc171
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Ccdc171 APN 4 83682324 nonsense probably null
IGL00707:Ccdc171 APN 4 83681155 missense probably benign 0.11
IGL00907:Ccdc171 APN 4 83864249 missense probably damaging 0.98
IGL01113:Ccdc171 APN 4 83661810 missense probably damaging 1.00
IGL01669:Ccdc171 APN 4 83681195 missense probably damaging 1.00
IGL01696:Ccdc171 APN 4 83655578 missense possibly damaging 0.66
IGL02006:Ccdc171 APN 4 83795242 missense possibly damaging 0.93
IGL02582:Ccdc171 APN 4 83743018 missense probably damaging 1.00
IGL03019:Ccdc171 APN 4 83795308 missense probably damaging 1.00
IGL03144:Ccdc171 APN 4 83818090 missense probably damaging 0.99
IGL03350:Ccdc171 APN 4 83681378 missense possibly damaging 0.67
IGL03377:Ccdc171 APN 4 83663517 missense probably damaging 1.00
PIT4131001:Ccdc171 UTSW 4 83661709
PIT4445001:Ccdc171 UTSW 4 83661747 missense probably damaging 1.00
R0219:Ccdc171 UTSW 4 83696441 splice site probably benign
R0284:Ccdc171 UTSW 4 83549738 missense possibly damaging 0.62
R0355:Ccdc171 UTSW 4 83635682 missense probably damaging 1.00
R1248:Ccdc171 UTSW 4 83681244 missense possibly damaging 0.46
R1278:Ccdc171 UTSW 4 83661858 missense possibly damaging 0.90
R1495:Ccdc171 UTSW 4 83681095 nonsense probably null
R1741:Ccdc171 UTSW 4 83620839 missense probably damaging 0.97
R1742:Ccdc171 UTSW 4 83681284 missense probably damaging 0.99
R1789:Ccdc171 UTSW 4 83554808 missense probably damaging 0.99
R1801:Ccdc171 UTSW 4 83546895 missense probably benign 0.41
R4204:Ccdc171 UTSW 4 83681155 missense probably benign 0.11
R4245:Ccdc171 UTSW 4 83554808 missense probably damaging 0.99
R4502:Ccdc171 UTSW 4 83864323 missense probably damaging 1.00
R4503:Ccdc171 UTSW 4 83864323 missense probably damaging 1.00
R4533:Ccdc171 UTSW 4 83657342 missense possibly damaging 0.66
R4589:Ccdc171 UTSW 4 83549618 missense probably benign 0.11
R4782:Ccdc171 UTSW 4 83681016 missense probably damaging 0.99
R4815:Ccdc171 UTSW 4 83795221 missense probably damaging 1.00
R4868:Ccdc171 UTSW 4 83694332 missense probably damaging 1.00
R4937:Ccdc171 UTSW 4 83549639 missense probably damaging 1.00
R5120:Ccdc171 UTSW 4 83558526 intron probably benign
R5185:Ccdc171 UTSW 4 83663655 missense possibly damaging 0.84
R5210:Ccdc171 UTSW 4 83554856 missense probably damaging 1.00
R5243:Ccdc171 UTSW 4 83604107 missense probably damaging 1.00
R5484:Ccdc171 UTSW 4 83693962 missense probably benign 0.00
R5574:Ccdc171 UTSW 4 83693753 missense probably damaging 1.00
R6053:Ccdc171 UTSW 4 83795219 missense probably damaging 1.00
R6135:Ccdc171 UTSW 4 83554850 missense probably benign 0.12
R6140:Ccdc171 UTSW 4 83696317 nonsense probably null
R6339:Ccdc171 UTSW 4 83742997 missense probably damaging 1.00
R6452:Ccdc171 UTSW 4 83864290 missense probably damaging 1.00
R7111:Ccdc171 UTSW 4 83693761 missense probably benign 0.00
U24488:Ccdc171 UTSW 4 83661717 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTACGGTTGGATGGCTTCATT -3'
(R):5'- CTGTGGGCAGCCATAAATAAATAC -3'

Sequencing Primer
(F):5'- TGAGCCAGCATGCTTACCTAGAG -3'
(R):5'- GGATGATATCCTCCAGATCCATC -3'
Posted On2016-04-15