Incidental Mutation 'R4926:Cyp3a25'
ID379024
Institutional Source Beutler Lab
Gene Symbol Cyp3a25
Ensembl Gene ENSMUSG00000029630
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 25
Synonyms
MMRRC Submission 042527-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R4926 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location145977194-146009618 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 145991456 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 260 (R260C)
Ref Sequence ENSEMBL: ENSMUSP00000065585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068317] [ENSMUST00000138870] [ENSMUST00000145062]
Predicted Effect probably damaging
Transcript: ENSMUST00000068317
AA Change: R260C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065585
Gene: ENSMUSG00000029630
AA Change: R260C

DomainStartEndE-ValueType
Pfam:p450 38 493 9.4e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138870
SMART Domains Protein: ENSMUSP00000116077
Gene: ENSMUSG00000029630

DomainStartEndE-ValueType
Pfam:p450 38 126 2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145062
SMART Domains Protein: ENSMUSP00000123615
Gene: ENSMUSG00000029630

DomainStartEndE-ValueType
Pfam:p450 38 148 3.9e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153808
Meta Mutation Damage Score 0.546 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 99% (87/88)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A T 9: 108,395,299 D136V probably damaging Het
Ankrd17 G A 5: 90,300,032 R217W probably damaging Het
Ankrd23 A T 1: 36,531,987 H102Q probably damaging Het
Arfip2 G T 7: 105,637,944 R138S probably damaging Het
Arhgap27 A T 11: 103,339,123 probably null Het
Atg2a T C 19: 6,257,533 L1499P probably damaging Het
Bnc2 A G 4: 84,276,179 S110P probably damaging Het
Ccdc171 T C 4: 83,558,592 probably benign Het
Ccdc7a A G 8: 128,980,054 probably benign Het
Chd5 T C 4: 152,383,311 S1689P probably benign Het
Corin A G 5: 72,372,182 C212R probably damaging Het
Cyp2c65 A G 19: 39,061,153 I42V probably benign Het
Dock6 T C 9: 21,845,791 Y116C probably damaging Het
Eif3a A G 19: 60,763,218 probably benign Het
Epop T C 11: 97,628,317 D322G probably damaging Het
Eps8l3 T A 3: 107,890,688 probably benign Het
Exph5 T C 9: 53,376,625 S1669P possibly damaging Het
Faah A T 4: 115,999,626 probably benign Het
Fanca A G 8: 123,303,985 C453R probably benign Het
Fcgbp T A 7: 28,086,235 C366S probably damaging Het
Fmn2 A G 1: 174,502,415 T124A unknown Het
Foxi3 C T 6: 70,957,012 S161L probably damaging Het
Foxo3 A T 10: 42,197,024 V499E probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gbgt1 T C 2: 28,503,170 V90A probably damaging Het
Gm839 A C 6: 89,212,599 noncoding transcript Het
Gtf3c2 T C 5: 31,169,123 E348G possibly damaging Het
Hnrnpm G T 17: 33,649,801 R551S probably damaging Het
Hspa1l A G 17: 34,978,223 T413A possibly damaging Het
Hspg2 T C 4: 137,542,530 Y2297H probably damaging Het
Ighv1-81 T A 12: 115,920,473 I53L probably benign Het
Kcnj11 C T 7: 46,099,120 V260I probably benign Het
Krt84 A G 15: 101,530,254 V266A probably benign Het
Lgals3bp T C 11: 118,393,955 Y266C probably damaging Het
Lrrc41 T C 4: 116,089,324 V412A possibly damaging Het
Map4k4 A T 1: 40,017,225 E1023D probably damaging Het
Mark3 T A 12: 111,618,324 L118* probably null Het
Mrgpra9 T A 7: 47,235,011 T303S possibly damaging Het
Mterf4 T C 1: 93,304,925 E68G probably benign Het
Nckap5 A C 1: 126,528,641 probably benign Het
Nox3 T A 17: 3,669,894 T339S probably damaging Het
Nrip2 A C 6: 128,408,374 H256P probably benign Het
Oas1d T C 5: 120,915,768 V97A probably benign Het
Obox2 T A 7: 15,397,177 probably null Het
Olfr979 T C 9: 40,001,023 probably null Het
Opa1 T C 16: 29,648,973 F989S possibly damaging Het
Padi1 T A 4: 140,824,847 I429F probably damaging Het
Paics A G 5: 76,961,204 D163G probably damaging Het
Pik3c2b G T 1: 133,099,626 E1288* probably null Het
Prdm16 A T 4: 154,341,552 V593D possibly damaging Het
Prpf39 A G 12: 65,044,056 I165M possibly damaging Het
Pth2r A G 1: 65,321,984 T26A probably benign Het
Ptpn21 T C 12: 98,715,195 probably null Het
Rab44 C T 17: 29,139,555 A239V probably benign Het
Rtcb T C 10: 85,955,736 N52S probably benign Het
Sapcd2 T A 2: 25,373,566 probably null Het
Scaf11 T C 15: 96,418,242 E1147G possibly damaging Het
Selenoo T C 15: 89,099,678 Y595H probably damaging Het
Slc2a5 G T 4: 150,120,742 E3* probably null Het
Snw1 A G 12: 87,452,658 V391A probably benign Het
Sorbs2 A G 8: 45,796,217 K755R probably benign Het
Sorbs3 G T 14: 70,186,945 P513T probably damaging Het
Sowaha T A 11: 53,479,510 E133V possibly damaging Het
Srsf5 T C 12: 80,947,301 probably benign Het
St8sia5 T A 18: 77,254,782 M396K possibly damaging Het
Tcp11l1 T C 2: 104,681,785 I501V probably benign Het
Tert A G 13: 73,648,389 K1080E possibly damaging Het
Tescl T A 7: 24,333,898 M1L possibly damaging Het
Thop1 T A 10: 81,073,367 probably null Het
Tmtc4 T C 14: 122,973,206 H80R probably damaging Het
Toe1 C T 4: 116,804,532 S480N probably damaging Het
Trap1 C A 16: 4,045,488 V557F probably benign Het
Trim30d T C 7: 104,483,357 E91G probably benign Het
Ttf1 C T 2: 29,064,656 H11Y possibly damaging Het
Ttll8 C A 15: 88,914,165 G789V probably damaging Het
Ulk4 A G 9: 121,258,732 F298S probably benign Het
Wwc1 C T 11: 35,889,400 A243T probably benign Het
Zfp248 A C 6: 118,429,826 H267Q possibly damaging Het
Zfyve26 T A 12: 79,275,011 M945L probably benign Het
Zufsp T C 10: 33,949,438 D16G probably damaging Het
Other mutations in Cyp3a25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Cyp3a25 APN 5 146001463 nonsense probably null
IGL00430:Cyp3a25 APN 5 145993360 missense probably damaging 1.00
IGL00803:Cyp3a25 APN 5 146001443 splice site probably benign
IGL00928:Cyp3a25 APN 5 145986954 missense possibly damaging 0.94
IGL01557:Cyp3a25 APN 5 145984901 missense probably damaging 1.00
IGL01997:Cyp3a25 APN 5 145994956 missense possibly damaging 0.92
IGL02140:Cyp3a25 APN 5 146009463 splice site probably benign
IGL02267:Cyp3a25 APN 5 145998552 missense possibly damaging 0.48
IGL02272:Cyp3a25 APN 5 145993265 intron probably benign
IGL02327:Cyp3a25 APN 5 145986921 missense possibly damaging 0.50
IGL02411:Cyp3a25 APN 5 146001447 critical splice donor site probably benign
IGL02504:Cyp3a25 APN 5 145993331 missense probably benign 0.03
IGL02653:Cyp3a25 APN 5 146003110 missense possibly damaging 0.95
R0378:Cyp3a25 UTSW 5 145986842 missense probably damaging 1.00
R0403:Cyp3a25 UTSW 5 145998513 missense probably damaging 1.00
R0685:Cyp3a25 UTSW 5 145998546 missense probably damaging 1.00
R0725:Cyp3a25 UTSW 5 145994936 missense probably damaging 1.00
R0798:Cyp3a25 UTSW 5 145991533 missense probably damaging 0.98
R1061:Cyp3a25 UTSW 5 145986833 missense probably benign
R1519:Cyp3a25 UTSW 5 146001447 critical splice donor site probably null
R1628:Cyp3a25 UTSW 5 146001463 nonsense probably null
R1822:Cyp3a25 UTSW 5 145984953 missense probably damaging 1.00
R1824:Cyp3a25 UTSW 5 145984953 missense probably damaging 1.00
R1864:Cyp3a25 UTSW 5 145994929 missense probably damaging 0.98
R2062:Cyp3a25 UTSW 5 145986969 splice site probably benign
R2401:Cyp3a25 UTSW 5 145986968 critical splice acceptor site probably null
R2516:Cyp3a25 UTSW 5 146003027 splice site probably null
R3080:Cyp3a25 UTSW 5 145998531 missense probably benign 0.33
R3236:Cyp3a25 UTSW 5 146003128 splice site probably benign
R3694:Cyp3a25 UTSW 5 145989976 splice site probably null
R3730:Cyp3a25 UTSW 5 146003081 missense probably damaging 1.00
R4112:Cyp3a25 UTSW 5 146003031 missense probably benign 0.18
R4258:Cyp3a25 UTSW 5 145991438 missense probably damaging 1.00
R4651:Cyp3a25 UTSW 5 145994891 missense probably benign 0.01
R4788:Cyp3a25 UTSW 5 145985082 nonsense probably null
R4899:Cyp3a25 UTSW 5 145977671 missense possibly damaging 0.59
R4952:Cyp3a25 UTSW 5 145991524 missense probably benign 0.01
R5270:Cyp3a25 UTSW 5 145981502 missense probably benign 0.36
R5595:Cyp3a25 UTSW 5 145994863 critical splice donor site probably null
R5659:Cyp3a25 UTSW 5 145991546 missense possibly damaging 0.69
R5787:Cyp3a25 UTSW 5 145998503 missense probably benign 0.14
R6307:Cyp3a25 UTSW 5 145994956 missense possibly damaging 0.92
R6380:Cyp3a25 UTSW 5 145998547 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATCATGACCACATCCTGGAA -3'
(R):5'- AGTCCAACATTGTGGGGAATTATT -3'

Sequencing Primer
(F):5'- TCCTGGAAATCATGGCCAAG -3'
(R):5'- GGTAAGTGTCTGTGAAAACTCCCC -3'
Posted On2016-04-15