Incidental Mutation 'R4907:Actn1'
ID379131
Institutional Source Beutler Lab
Gene Symbol Actn1
Ensembl Gene ENSMUSG00000015143
Gene Nameactinin, alpha 1
Synonyms
MMRRC Submission 042509-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.500) question?
Stock #R4907 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location80167547-80260371 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 80181414 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 394 (H394P)
Ref Sequence ENSEMBL: ENSMUSP00000021554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021554] [ENSMUST00000167327]
Predicted Effect probably damaging
Transcript: ENSMUST00000021554
AA Change: H394P

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021554
Gene: ENSMUSG00000015143
AA Change: H394P

DomainStartEndE-ValueType
CH 33 133 4.24e-23 SMART
CH 146 245 5.06e-21 SMART
Pfam:Spectrin 274 384 5.9e-17 PFAM
SPEC 397 498 1.69e-25 SMART
SPEC 512 619 1.47e-2 SMART
Pfam:Spectrin 630 733 4.7e-14 PFAM
EFh 750 778 1.73e-5 SMART
EFh 791 819 8.13e-2 SMART
efhand_Ca_insen 822 888 5.22e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167327
AA Change: H394P

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127176
Gene: ENSMUSG00000015143
AA Change: H394P

DomainStartEndE-ValueType
CH 33 133 4.24e-23 SMART
CH 146 245 5.06e-21 SMART
Pfam:Spectrin 274 384 1.7e-17 PFAM
SPEC 397 498 1.69e-25 SMART
SPEC 512 619 1.47e-2 SMART
Pfam:Spectrin 630 733 8.4e-14 PFAM
EFh 750 778 1.36e0 SMART
EFh 786 814 8.13e-2 SMART
efhand_Ca_insen 817 883 5.22e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218874
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 98% (89/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, cytoskeletal, alpha actinin isoform and maps to the same site as the structurally similar erythroid beta spectrin gene. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik G T 1: 57,383,191 G242V probably damaging Het
4933412E24Rik T C 15: 60,016,108 E161G probably benign Het
Abcc5 A G 16: 20,376,546 S734P possibly damaging Het
Adam8 A T 7: 139,989,373 D144E probably benign Het
Ankrd50 T A 3: 38,454,973 K1082* probably null Het
Ankrd50 A T 3: 38,456,675 N514K probably damaging Het
Atp4a A G 7: 30,719,092 I602V possibly damaging Het
Baz2a A G 10: 128,110,808 T64A probably damaging Het
Btbd19 A G 4: 117,120,567 probably benign Het
Casz1 T A 4: 148,944,541 S1148T probably damaging Het
Ccdc18 T A 5: 108,136,141 D103E probably benign Het
Cd209d T C 8: 3,877,948 N52S probably benign Het
Cdh7 T A 1: 110,138,323 Y776N probably damaging Het
Cdk14 A G 5: 5,249,140 V101A probably damaging Het
Cldn22 T C 8: 47,824,707 V60A probably benign Het
Clec10a G A 11: 70,169,971 G183D probably benign Het
Cnga3 T C 1: 37,241,942 probably null Het
Cts3 A T 13: 61,566,820 F224I probably benign Het
Fbxo40 A G 16: 36,969,702 Y349H probably benign Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Gm10029 A T 13: 6,662,556 noncoding transcript Het
Gm14399 T A 2: 175,131,389 probably benign Het
Gm9932 T C 5: 100,199,155 noncoding transcript Het
Immp1l A G 2: 105,937,117 Y107C probably damaging Het
Ism1 G T 2: 139,678,752 G28V probably benign Het
Klf1 C A 8: 84,903,185 S213* probably null Het
Krt12 T C 11: 99,418,362 E329G probably damaging Het
Lama2 A T 10: 27,164,946 N1460K probably benign Het
Llgl2 T A 11: 115,853,974 Y932* probably null Het
Lrrc7 T C 3: 158,161,240 I955V probably damaging Het
Ltbp1 A G 17: 75,005,904 R7G probably benign Het
Mcm3ap A G 10: 76,493,441 E1152G probably damaging Het
Mgam2-ps T C 6: 40,834,743 noncoding transcript Het
Mical3 T A 6: 121,007,298 M206L probably benign Het
Mndal T G 1: 173,862,690 N358T probably damaging Het
Nckap5 A G 1: 126,026,152 S824P possibly damaging Het
Ndufb2 T C 6: 39,596,620 probably benign Het
Nfatc3 C A 8: 106,079,727 H401Q probably damaging Het
Npas2 T C 1: 39,361,985 V810A unknown Het
Nt5c2 A G 19: 46,896,539 V245A possibly damaging Het
Olfr1463 A G 19: 13,234,793 D181G probably damaging Het
Olfr350 A T 2: 36,850,258 I71F probably benign Het
Olfr615 A G 7: 103,561,034 M186V possibly damaging Het
Olfr651 A G 7: 104,553,311 R131G probably damaging Het
Olfr984 A T 9: 40,100,659 M277K probably benign Het
Otof A T 5: 30,378,661 probably null Het
Pck1 C T 2: 173,157,023 T358I probably damaging Het
Pclo T C 5: 14,680,051 probably benign Het
Pgm1 T A 5: 64,103,878 F238L probably benign Het
Pgr G A 9: 8,947,043 probably benign Het
Pkd1l3 T A 8: 109,640,843 V1224E probably damaging Het
Pkd2l1 A G 19: 44,154,142 V487A possibly damaging Het
Pkhd1 T C 1: 20,209,226 D2956G probably damaging Het
Rexo2 A T 9: 48,479,403 probably null Het
Rgs22 T A 15: 36,087,424 L573F possibly damaging Het
Rufy3 T G 5: 88,584,192 I18S possibly damaging Het
Slc30a9 T C 5: 67,346,162 L393P probably damaging Het
Snw1 T C 12: 87,459,489 I214V probably benign Het
Sorbs1 G A 19: 40,340,047 Q595* probably null Het
Spata21 T A 4: 141,097,121 probably null Het
Ss18l1 G T 2: 180,063,399 probably null Het
Tmem163 A T 1: 127,519,370 L176H probably damaging Het
Tpd52 T C 3: 8,944,608 probably null Het
Tpsab1 T A 17: 25,343,462 Y297F possibly damaging Het
Trim55 A G 3: 19,674,374 T450A probably benign Het
Ttf1 C T 2: 29,064,656 H11Y possibly damaging Het
Txndc11 A T 16: 11,088,534 H377Q probably benign Het
Usp17la A G 7: 104,861,148 Y320C probably damaging Het
Vmn2r109 T C 17: 20,550,086 N547D probably damaging Het
Vmn2r54 A T 7: 12,616,223 probably null Het
Wdr33 T C 18: 31,906,993 *1331Q probably null Het
Wdr34 A G 2: 30,032,460 probably null Het
Wdr90 T A 17: 25,860,650 probably benign Het
Xpo7 T C 14: 70,670,629 M903V probably benign Het
Zfhx3 T A 8: 108,793,354 S369R probably damaging Het
Zfp808 T C 13: 62,171,473 F172S possibly damaging Het
Zfp821 A G 8: 109,723,993 E55G probably benign Het
Zfp964 T C 8: 69,663,322 Y191H possibly damaging Het
Zfyve1 T C 12: 83,574,872 T250A probably damaging Het
Other mutations in Actn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Actn1 APN 12 80199072 splice site probably null
IGL01152:Actn1 APN 12 80199046 missense probably damaging 1.00
IGL01386:Actn1 APN 12 80193672 missense probably benign 0.03
IGL01890:Actn1 APN 12 80184868 missense probably damaging 0.99
IGL01937:Actn1 APN 12 80171763 missense probably benign 0.03
IGL02142:Actn1 APN 12 80176155 critical splice donor site probably null
IGL02191:Actn1 APN 12 80174109 missense probably benign
IGL02217:Actn1 APN 12 80174094 nonsense probably null
IGL02230:Actn1 APN 12 80171830 missense probably benign 0.02
IGL03163:Actn1 APN 12 80181417 missense probably benign 0.33
IGL03401:Actn1 APN 12 80168967 nonsense probably null
R0538:Actn1 UTSW 12 80260100 unclassified probably benign
R0546:Actn1 UTSW 12 80178434 missense probably benign
R0583:Actn1 UTSW 12 80199029 missense probably damaging 1.00
R0606:Actn1 UTSW 12 80174647 splice site probably benign
R1340:Actn1 UTSW 12 80173144 critical splice acceptor site probably null
R1519:Actn1 UTSW 12 80205078 missense probably damaging 1.00
R1572:Actn1 UTSW 12 80172957 splice site probably benign
R1619:Actn1 UTSW 12 80173022 missense probably damaging 1.00
R1677:Actn1 UTSW 12 80260032 missense probably benign 0.02
R1994:Actn1 UTSW 12 80204971 nonsense probably null
R2102:Actn1 UTSW 12 80183517 missense probably benign 0.38
R2157:Actn1 UTSW 12 80173117 missense probably benign 0.04
R2191:Actn1 UTSW 12 80171802 nonsense probably null
R2519:Actn1 UTSW 12 80192389 missense probably damaging 1.00
R2988:Actn1 UTSW 12 80192388 missense possibly damaging 0.78
R4024:Actn1 UTSW 12 80168477 missense probably damaging 1.00
R4589:Actn1 UTSW 12 80171799 missense possibly damaging 0.53
R4936:Actn1 UTSW 12 80172998 missense probably benign 0.09
R4966:Actn1 UTSW 12 80173130 missense probably benign 0.01
R4972:Actn1 UTSW 12 80173039 missense probably benign 0.35
R5395:Actn1 UTSW 12 80170703 missense probably benign
R5460:Actn1 UTSW 12 80183568 missense probably benign 0.00
R5467:Actn1 UTSW 12 80176217 missense possibly damaging 0.86
R5470:Actn1 UTSW 12 80168941 missense probably damaging 0.99
R5661:Actn1 UTSW 12 80184844 missense probably benign 0.09
R5985:Actn1 UTSW 12 80168395 missense probably damaging 1.00
R6020:Actn1 UTSW 12 80174455 splice site probably null
R6042:Actn1 UTSW 12 80177249 missense probably benign 0.04
R6389:Actn1 UTSW 12 80174522 missense probably benign
R6499:Actn1 UTSW 12 80168417 missense possibly damaging 0.59
R6709:Actn1 UTSW 12 80193644 missense probably damaging 1.00
R7016:Actn1 UTSW 12 80172968 missense possibly damaging 0.94
R7116:Actn1 UTSW 12 80204977 missense probably damaging 1.00
R7173:Actn1 UTSW 12 80177259 missense possibly damaging 0.70
R7183:Actn1 UTSW 12 80168932 missense possibly damaging 0.87
R7291:Actn1 UTSW 12 80174085 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGCAGAGACAGATAAGATGCC -3'
(R):5'- TCCAAGAGTCAGGGAAATGC -3'

Sequencing Primer
(F):5'- GAGACAGATAAGATGCCATCCAC -3'
(R):5'- CACGGGTGCTAAGATCTGG -3'
Posted On2016-04-15