Incidental Mutation 'R4908:Reln'
ID379176
Institutional Source Beutler Lab
Gene Symbol Reln
Ensembl Gene ENSMUSG00000042453
Gene Namereelin
Synonyms
MMRRC Submission 042510-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R4908 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location21884454-22344702 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21979720 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1599 (V1599A)
Ref Sequence ENSEMBL: ENSMUSP00000124052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]
Predicted Effect probably benign
Transcript: ENSMUST00000062372
AA Change: V1599A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: V1599A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 40 172 6.1e-24 PFAM
internal_repeat_3 195 360 5.04e-6 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3450 3457 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161353
Predicted Effect probably benign
Transcript: ENSMUST00000161356
AA Change: V1599A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: V1599A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 54 171 2.9e-10 PFAM
internal_repeat_3 195 360 5.06e-6 PROSPERO
internal_repeat_2 207 413 3.41e-11 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
internal_repeat_2 1452 1660 3.41e-11 PROSPERO
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3452 3459 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059G10Rik T A 9: 122,948,943 I79L probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Acaa1a G A 9: 119,348,706 S218N probably benign Het
Acsm5 A T 7: 119,538,091 I377F probably damaging Het
Ahnak2 T C 12: 112,775,272 T789A probably benign Het
Ak9 A T 10: 41,420,682 T1475S unknown Het
AU040320 A T 4: 126,853,288 N1028Y probably damaging Het
Bahcc1 T A 11: 120,287,754 S2380T probably benign Het
Cadps A G 14: 12,536,386 Y525H probably damaging Het
Casp8ap2 A G 4: 32,639,905 T320A possibly damaging Het
Ccdc138 A G 10: 58,544,995 N483D possibly damaging Het
Ccdc39 G A 3: 33,839,093 probably null Het
Cd300c2 T C 11: 114,996,946 N210S probably damaging Het
Cd84 A G 1: 171,872,865 D183G probably damaging Het
Cep95 C T 11: 106,811,346 P390S probably damaging Het
Chd9 A T 8: 91,015,249 H1622L possibly damaging Het
Cilp C A 9: 65,278,020 Q466K probably benign Het
Cinp T A 12: 110,884,053 T5S probably damaging Het
Clec4a2 T C 6: 123,142,503 L238S probably damaging Het
Cntrob T C 11: 69,320,906 Y164C probably damaging Het
Col6a3 A G 1: 90,807,524 L1408P probably damaging Het
Cul3 G A 1: 80,280,915 S468L possibly damaging Het
Dnah11 T A 12: 118,126,883 D1081V probably benign Het
Dnah2 C A 11: 69,521,147 V263L probably benign Het
Efna3 C G 3: 89,315,498 R185P probably damaging Het
F5 A T 1: 164,211,820 I2000F probably damaging Het
Fancm G A 12: 65,094,871 G422E probably benign Het
Gcnt2 A T 13: 40,860,734 D127V probably damaging Het
Gm21798 G T 15: 64,817,769 probably benign Het
Gm340 T A 19: 41,584,162 V452D probably benign Het
Gramd1a A C 7: 31,138,867 S320R probably benign Het
Grn T C 11: 102,436,518 probably benign Het
Helq A T 5: 100,762,641 probably null Het
Herc2 A G 7: 56,177,912 I2914V probably benign Het
Hnrnph1 T C 11: 50,378,410 V27A probably damaging Het
Hs1bp3 G T 12: 8,324,007 G182C probably damaging Het
Idnk C T 13: 58,163,453 P78L probably benign Het
Il10ra T C 9: 45,255,621 D544G probably benign Het
Inpp5e T C 2: 26,400,906 D383G probably damaging Het
Jak1 A T 4: 101,179,714 V243D probably damaging Het
Kcnma1 A T 14: 23,309,152 S1036T probably damaging Het
Kif26a G A 12: 112,157,342 C127Y probably damaging Het
Kif2c T C 4: 117,166,411 E368G probably damaging Het
Lasp1 T A 11: 97,833,704 probably null Het
Lrrtm1 C G 6: 77,244,678 H373D probably benign Het
Matr3 T A 18: 35,572,701 D226E probably damaging Het
Mmp17 G A 5: 129,605,666 W456* probably null Het
Mpp4 T C 1: 59,125,589 E463G probably damaging Het
Myh6 A C 14: 54,956,962 F737V probably damaging Het
Nars2 T A 7: 97,023,741 D271E probably benign Het
Nav2 A G 7: 49,604,510 E2352G probably damaging Het
Nckap1 A G 2: 80,523,374 probably null Het
Nckap5 A T 1: 126,027,587 S477R probably damaging Het
Nek11 T G 9: 105,298,289 I319L probably benign Het
Neto2 A G 8: 85,669,764 I84T probably damaging Het
Nlrp9a A T 7: 26,550,944 I45F probably damaging Het
Numa1 G A 7: 102,012,805 R548H probably damaging Het
Olfr1154 A T 2: 87,903,189 N162K probably damaging Het
Olfr1186 T A 2: 88,525,910 I109N probably damaging Het
Olfr1258 A T 2: 89,930,579 M257L probably benign Het
Olfr1280 T A 2: 111,316,229 F250Y probably benign Het
Olfr292 A C 7: 86,695,187 I244L probably benign Het
Olfr694 A T 7: 106,689,533 L66H probably damaging Het
Olfr713 A C 7: 107,036,157 M1L probably benign Het
Olfr843 A G 9: 19,248,853 V182A probably benign Het
Pcdhb16 T A 18: 37,479,841 probably null Het
Pdcd10 T C 3: 75,541,246 T4A probably damaging Het
Pgc A T 17: 47,728,894 Y71F probably damaging Het
Phlpp1 G A 1: 106,389,751 G1234E probably damaging Het
Prr27 T C 5: 87,843,029 F167L probably benign Het
Prrc2b T A 2: 32,226,318 S1421T possibly damaging Het
Pxmp2 A G 5: 110,283,652 V75A probably benign Het
Pygl A T 12: 70,197,033 M545K probably null Het
Ranbp9 A G 13: 43,421,257 Y412H possibly damaging Het
Rcc1 A G 4: 132,337,753 V140A probably damaging Het
Rhebl1 A T 15: 98,879,022 D122E probably damaging Het
Rock2 C T 12: 16,959,491 L676F probably benign Het
Scn9a A T 2: 66,526,743 D1062E probably benign Het
Sec63 T C 10: 42,805,190 I390T probably damaging Het
Slc10a6 T C 5: 103,606,627 E346G probably benign Het
Slc12a3 G A 8: 94,348,588 V737M possibly damaging Het
Slc12a8 T C 16: 33,606,259 probably null Het
Slc25a38 T A 9: 120,120,288 I102N probably damaging Het
Spg7 T A 8: 123,080,655 V390E probably damaging Het
Tbc1d20 T C 2: 152,302,308 V75A probably benign Het
Tesk1 T A 4: 43,445,555 C243* probably null Het
Ttk T A 9: 83,843,686 N220K possibly damaging Het
Ttll5 A G 12: 85,919,174 E651G probably benign Het
Tubd1 T C 11: 86,567,053 Y426H probably damaging Het
Uba6 T C 5: 86,140,434 silent Het
Ube2ql1 G A 13: 69,704,170 R263W probably damaging Het
Vmn2r117 C T 17: 23,459,838 G804D probably damaging Het
Vmn2r25 C T 6: 123,828,447 E484K probably benign Het
Vmn2r4 T A 3: 64,389,055 I770F possibly damaging Het
Vmn2r82 G A 10: 79,378,755 V191M probably benign Het
Zbtb45 C T 7: 13,008,110 V74M probably damaging Het
Zfp366 T C 13: 99,234,101 V443A possibly damaging Het
Zfyve1 A T 12: 83,551,571 C628S probably damaging Het
Zfyve26 A T 12: 79,249,695 probably null Het
Other mutations in Reln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Reln APN 5 22039565 missense possibly damaging 0.57
IGL00091:Reln APN 5 22039565 missense possibly damaging 0.57
IGL00432:Reln APN 5 22010127 missense probably damaging 1.00
IGL00433:Reln APN 5 22045009 missense probably damaging 1.00
IGL00576:Reln APN 5 22154950 missense probably benign 0.01
IGL00755:Reln APN 5 22060380 missense probably damaging 0.98
IGL00777:Reln APN 5 22018850 critical splice donor site probably null
IGL00900:Reln APN 5 21980117 missense probably damaging 0.98
IGL01067:Reln APN 5 21979666 missense probably damaging 1.00
IGL01104:Reln APN 5 21986967 missense probably damaging 0.99
IGL01141:Reln APN 5 21969033 missense probably damaging 1.00
IGL01141:Reln APN 5 21919069 missense probably damaging 1.00
IGL01333:Reln APN 5 22171251 missense probably damaging 0.99
IGL01341:Reln APN 5 21969079 missense probably damaging 1.00
IGL01354:Reln APN 5 21919175 nonsense probably null
IGL01361:Reln APN 5 21919021 missense probably benign 0.06
IGL01446:Reln APN 5 21969317 missense probably damaging 0.99
IGL01448:Reln APN 5 22040405 missense probably benign 0.40
IGL01612:Reln APN 5 21896930 missense probably damaging 0.99
IGL01695:Reln APN 5 21920438 missense probably damaging 1.00
IGL01718:Reln APN 5 21947514 missense possibly damaging 0.60
IGL01749:Reln APN 5 22344246 nonsense probably null
IGL01875:Reln APN 5 21904717 missense probably benign
IGL02013:Reln APN 5 21950879 missense probably damaging 1.00
IGL02031:Reln APN 5 21979016 missense probably damaging 0.99
IGL02186:Reln APN 5 21909958 missense probably damaging 1.00
IGL02228:Reln APN 5 21904731 missense probably damaging 0.99
IGL02248:Reln APN 5 21910992 missense probably damaging 1.00
IGL02336:Reln APN 5 21929134 missense probably damaging 1.00
IGL02352:Reln APN 5 22039565 missense possibly damaging 0.57
IGL02359:Reln APN 5 22039565 missense possibly damaging 0.57
IGL02376:Reln APN 5 22080791 nonsense probably null
IGL02408:Reln APN 5 21901619 missense probably benign 0.44
IGL02415:Reln APN 5 21971951 missense possibly damaging 0.91
IGL02512:Reln APN 5 22040427 missense probably benign 0.00
IGL02540:Reln APN 5 22034752 missense probably damaging 0.96
IGL02624:Reln APN 5 22103357 missense probably benign 0.09
IGL02720:Reln APN 5 21997941 missense probably damaging 0.99
IGL02894:Reln APN 5 21885548 missense possibly damaging 0.72
IGL02999:Reln APN 5 21995365 missense probably damaging 1.00
IGL03125:Reln APN 5 21910844 missense probably damaging 1.00
IGL03298:Reln APN 5 21910836 missense probably damaging 0.99
fishing UTSW 5 21896841 missense probably damaging 1.00
P0020:Reln UTSW 5 22106060 missense possibly damaging 0.91
R0018:Reln UTSW 5 21925371 missense probably benign 0.01
R0105:Reln UTSW 5 22048815 missense probably damaging 0.99
R0105:Reln UTSW 5 22048815 missense probably damaging 0.99
R0127:Reln UTSW 5 22004136 missense probably damaging 1.00
R0135:Reln UTSW 5 22128649 missense probably damaging 0.99
R0144:Reln UTSW 5 21948449 missense probably damaging 0.97
R0240:Reln UTSW 5 22106045 missense probably benign 0.36
R0240:Reln UTSW 5 22106045 missense probably benign 0.36
R0242:Reln UTSW 5 21942597 critical splice donor site probably null
R0242:Reln UTSW 5 21942597 critical splice donor site probably null
R0266:Reln UTSW 5 21988776 missense probably damaging 1.00
R0269:Reln UTSW 5 21920537 missense probably damaging 1.00
R0280:Reln UTSW 5 22227513 splice site probably benign
R0333:Reln UTSW 5 21929242 missense probably damaging 0.97
R0357:Reln UTSW 5 21950822 missense probably damaging 1.00
R0359:Reln UTSW 5 22048800 missense probably damaging 0.98
R0506:Reln UTSW 5 21920496 missense probably damaging 0.97
R0534:Reln UTSW 5 21947408 missense probably damaging 0.99
R0535:Reln UTSW 5 22051276 splice site probably benign
R0541:Reln UTSW 5 21980109 missense possibly damaging 0.88
R0615:Reln UTSW 5 22010150 missense probably benign 0.36
R0617:Reln UTSW 5 21920537 missense probably damaging 1.00
R0634:Reln UTSW 5 22018869 missense probably damaging 1.00
R0653:Reln UTSW 5 21913230 missense probably benign 0.44
R0704:Reln UTSW 5 21896811 missense probably damaging 0.99
R0706:Reln UTSW 5 21896811 missense probably damaging 0.99
R0959:Reln UTSW 5 22227628 missense probably damaging 0.96
R1066:Reln UTSW 5 22034664 missense probably damaging 1.00
R1110:Reln UTSW 5 22034775 missense probably benign
R1163:Reln UTSW 5 21899029 missense probably benign 0.03
R1222:Reln UTSW 5 21986955 missense probably null 0.97
R1226:Reln UTSW 5 21910866 missense probably damaging 1.00
R1440:Reln UTSW 5 22128602 splice site probably benign
R1532:Reln UTSW 5 22034744 missense probably damaging 0.99
R1552:Reln UTSW 5 21960378 missense probably benign 0.01
R1565:Reln UTSW 5 21925213 missense probably benign 0.05
R1618:Reln UTSW 5 22060368 missense probably benign 0.01
R1636:Reln UTSW 5 21998683 missense probably damaging 0.99
R1664:Reln UTSW 5 21929086 missense probably damaging 1.00
R1716:Reln UTSW 5 21955095 missense probably damaging 0.98
R1759:Reln UTSW 5 22010289 missense probably damaging 0.99
R1835:Reln UTSW 5 21979002 missense probably damaging 1.00
R1907:Reln UTSW 5 22044962 critical splice donor site probably null
R1991:Reln UTSW 5 21969360 missense possibly damaging 0.56
R2046:Reln UTSW 5 21942627 missense probably benign 0.01
R2072:Reln UTSW 5 21919177 missense probably damaging 1.00
R2103:Reln UTSW 5 21969360 missense possibly damaging 0.56
R2119:Reln UTSW 5 22019000 missense probably damaging 1.00
R2120:Reln UTSW 5 21969085 missense probably damaging 1.00
R2216:Reln UTSW 5 22048005 missense probably benign 0.30
R2219:Reln UTSW 5 21972047 missense possibly damaging 0.88
R2228:Reln UTSW 5 21987078 missense possibly damaging 0.69
R2306:Reln UTSW 5 21896786 missense probably damaging 1.00
R2316:Reln UTSW 5 22154956 missense probably benign 0.00
R2321:Reln UTSW 5 21915020 missense probably damaging 0.99
R2512:Reln UTSW 5 21979690 missense possibly damaging 0.89
R2519:Reln UTSW 5 22344369 missense unknown
R2870:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2870:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2871:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2871:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2872:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2872:Reln UTSW 5 22049791 missense possibly damaging 0.95
R3195:Reln UTSW 5 22040420 missense possibly damaging 0.72
R3545:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3546:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3547:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3706:Reln UTSW 5 21995589 splice site probably benign
R3713:Reln UTSW 5 21904734 missense probably damaging 0.99
R3770:Reln UTSW 5 21948566 missense probably damaging 1.00
R3836:Reln UTSW 5 21911014 missense probably damaging 1.00
R3887:Reln UTSW 5 21910849 missense possibly damaging 0.92
R3972:Reln UTSW 5 21979001 missense probably damaging 0.99
R3975:Reln UTSW 5 21995366 missense possibly damaging 0.57
R4022:Reln UTSW 5 22227630 missense probably benign 0.45
R4044:Reln UTSW 5 22128632 missense possibly damaging 0.82
R4107:Reln UTSW 5 22034584 missense probably damaging 1.00
R4297:Reln UTSW 5 21920487 missense probably damaging 0.99
R4298:Reln UTSW 5 21920487 missense probably damaging 0.99
R4299:Reln UTSW 5 21920487 missense probably damaging 0.99
R4518:Reln UTSW 5 21901743 missense probably benign 0.44
R4615:Reln UTSW 5 21972872 missense possibly damaging 0.95
R4713:Reln UTSW 5 22152463 missense probably benign 0.17
R4720:Reln UTSW 5 22286896 missense possibly damaging 0.71
R4721:Reln UTSW 5 21919222 missense probably damaging 0.99
R4771:Reln UTSW 5 22049700 missense probably damaging 1.00
R4794:Reln UTSW 5 22344185 missense probably damaging 0.98
R4840:Reln UTSW 5 22018846 splice site probably null
R4860:Reln UTSW 5 21901751 missense probably benign 0.06
R4860:Reln UTSW 5 21901751 missense probably benign 0.06
R4896:Reln UTSW 5 21955238 missense probably damaging 1.00
R4912:Reln UTSW 5 21925193 missense probably benign 0.29
R4922:Reln UTSW 5 21995587 critical splice acceptor site probably null
R4975:Reln UTSW 5 21960426 missense probably damaging 1.00
R4976:Reln UTSW 5 21971870 missense probably benign 0.05
R5020:Reln UTSW 5 22034638 missense probably damaging 1.00
R5037:Reln UTSW 5 21948512 missense probably damaging 1.00
R5082:Reln UTSW 5 21896077 missense probably benign 0.00
R5119:Reln UTSW 5 21971870 missense probably benign 0.05
R5125:Reln UTSW 5 21913241 missense possibly damaging 0.78
R5137:Reln UTSW 5 21955181 missense probably damaging 1.00
R5152:Reln UTSW 5 21948629 missense probably damaging 1.00
R5154:Reln UTSW 5 21988765 missense probably damaging 0.99
R5259:Reln UTSW 5 22103397 missense possibly damaging 0.83
R5283:Reln UTSW 5 22011163 missense probably damaging 1.00
R5386:Reln UTSW 5 22039529 missense probably benign
R5400:Reln UTSW 5 21979714 missense probably damaging 1.00
R5478:Reln UTSW 5 22004203 missense probably benign 0.00
R5514:Reln UTSW 5 21971885 missense possibly damaging 0.93
R5529:Reln UTSW 5 21932715 missense possibly damaging 0.71
R5611:Reln UTSW 5 22039665 nonsense probably null
R5648:Reln UTSW 5 21998572 missense probably benign 0.04
R5649:Reln UTSW 5 21901625 missense probably benign 0.33
R5744:Reln UTSW 5 22106083 missense probably null 0.39
R5782:Reln UTSW 5 22018056 missense probably benign 0.01
R5815:Reln UTSW 5 21947433 missense probably damaging 0.99
R5838:Reln UTSW 5 21899113 missense probably damaging 0.97
R6162:Reln UTSW 5 21911050 missense probably damaging 1.00
R6219:Reln UTSW 5 21948596 missense probably damaging 1.00
R6259:Reln UTSW 5 22060333 missense probably damaging 0.99
R6279:Reln UTSW 5 21896841 missense probably damaging 1.00
R6299:Reln UTSW 5 22286944 missense possibly damaging 0.71
R6300:Reln UTSW 5 21896841 missense probably damaging 1.00
R6314:Reln UTSW 5 22152484 nonsense probably null
R6351:Reln UTSW 5 21901663 nonsense probably null
R6369:Reln UTSW 5 22051361 missense probably benign 0.03
R6371:Reln UTSW 5 21995513 missense probably benign
R6374:Reln UTSW 5 22080714 missense probably benign 0.06
R6425:Reln UTSW 5 21911020 nonsense probably null
R6442:Reln UTSW 5 21932776 missense probably benign
R6445:Reln UTSW 5 21919214 missense probably benign 0.05
R6554:Reln UTSW 5 21896840 missense probably damaging 1.00
R6641:Reln UTSW 5 21929134 missense probably damaging 1.00
R6768:Reln UTSW 5 21978907 missense probably damaging 0.99
R6859:Reln UTSW 5 22034570 missense probably damaging 1.00
R6896:Reln UTSW 5 21899179 missense probably benign 0.18
R6932:Reln UTSW 5 21985857 missense probably benign 0.00
R6948:Reln UTSW 5 21972035 missense probably damaging 1.00
R6959:Reln UTSW 5 21976564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTGGAGGACGATGCACAC -3'
(R):5'- CACATAGCATCCATATCCAATGTG -3'

Sequencing Primer
(F):5'- TCCATCAGCAAAGGAAGTTAAAC -3'
(R):5'- TGGTCACGGAGATATTCC -3'
Posted On2016-04-15