Incidental Mutation 'R4908:Chd9'
ID379201
Institutional Source Beutler Lab
Gene Symbol Chd9
Ensembl Gene ENSMUSG00000056608
Gene Namechromodomain helicase DNA binding protein 9
Synonyms1810014J18Rik, AD013, 9030205D12Rik, A330063D19Rik
MMRRC Submission 042510-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.551) question?
Stock #R4908 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location90828352-91054516 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91015249 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 1622 (H1622L)
Ref Sequence ENSEMBL: ENSMUSP00000147407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048665] [ENSMUST00000109614] [ENSMUST00000209203] [ENSMUST00000209423]
Predicted Effect unknown
Transcript: ENSMUST00000048665
AA Change: H1622L
SMART Domains Protein: ENSMUSP00000046356
Gene: ENSMUSG00000056608
AA Change: H1622L

DomainStartEndE-ValueType
low complexity region 323 334 N/A INTRINSIC
low complexity region 586 605 N/A INTRINSIC
CHROMO 687 753 2.41e-10 SMART
CHROMO 770 828 4.35e-8 SMART
DEXDc 855 1056 3.8e-36 SMART
Blast:DEXDc 1149 1174 7e-6 BLAST
HELICc 1211 1295 2.86e-22 SMART
low complexity region 1462 1475 N/A INTRINSIC
Blast:DEXDc 1506 1551 3e-16 BLAST
low complexity region 2048 2067 N/A INTRINSIC
low complexity region 2127 2199 N/A INTRINSIC
BRK 2456 2505 6.77e-25 SMART
BRK 2530 2574 1.5e-17 SMART
low complexity region 2594 2608 N/A INTRINSIC
low complexity region 2609 2639 N/A INTRINSIC
low complexity region 2642 2659 N/A INTRINSIC
low complexity region 2690 2704 N/A INTRINSIC
low complexity region 2746 2771 N/A INTRINSIC
low complexity region 2802 2813 N/A INTRINSIC
low complexity region 2843 2869 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000109614
AA Change: H1622L
SMART Domains Protein: ENSMUSP00000105243
Gene: ENSMUSG00000056608
AA Change: H1622L

DomainStartEndE-ValueType
low complexity region 323 334 N/A INTRINSIC
low complexity region 586 605 N/A INTRINSIC
CHROMO 687 753 2.41e-10 SMART
CHROMO 770 828 4.35e-8 SMART
DEXDc 855 1056 3.8e-36 SMART
Blast:DEXDc 1149 1174 7e-6 BLAST
HELICc 1211 1295 2.86e-22 SMART
low complexity region 1462 1475 N/A INTRINSIC
Blast:DEXDc 1506 1551 3e-16 BLAST
low complexity region 2048 2067 N/A INTRINSIC
low complexity region 2127 2199 N/A INTRINSIC
BRK 2472 2521 6.77e-25 SMART
BRK 2546 2590 1.5e-17 SMART
low complexity region 2610 2624 N/A INTRINSIC
low complexity region 2625 2655 N/A INTRINSIC
low complexity region 2658 2675 N/A INTRINSIC
low complexity region 2706 2720 N/A INTRINSIC
low complexity region 2762 2787 N/A INTRINSIC
low complexity region 2818 2829 N/A INTRINSIC
low complexity region 2859 2885 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209203
AA Change: H1622L

PolyPhen 2 Score 0.496 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect unknown
Transcript: ENSMUST00000209423
AA Change: H1622L
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059G10Rik T A 9: 122,948,943 I79L probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Acaa1a G A 9: 119,348,706 S218N probably benign Het
Acsm5 A T 7: 119,538,091 I377F probably damaging Het
Ahnak2 T C 12: 112,775,272 T789A probably benign Het
Ak9 A T 10: 41,420,682 T1475S unknown Het
AU040320 A T 4: 126,853,288 N1028Y probably damaging Het
Bahcc1 T A 11: 120,287,754 S2380T probably benign Het
Cadps A G 14: 12,536,386 Y525H probably damaging Het
Casp8ap2 A G 4: 32,639,905 T320A possibly damaging Het
Ccdc138 A G 10: 58,544,995 N483D possibly damaging Het
Ccdc39 G A 3: 33,839,093 probably null Het
Cd300c2 T C 11: 114,996,946 N210S probably damaging Het
Cd84 A G 1: 171,872,865 D183G probably damaging Het
Cep95 C T 11: 106,811,346 P390S probably damaging Het
Cilp C A 9: 65,278,020 Q466K probably benign Het
Cinp T A 12: 110,884,053 T5S probably damaging Het
Clec4a2 T C 6: 123,142,503 L238S probably damaging Het
Cntrob T C 11: 69,320,906 Y164C probably damaging Het
Col6a3 A G 1: 90,807,524 L1408P probably damaging Het
Cul3 G A 1: 80,280,915 S468L possibly damaging Het
Dnah11 T A 12: 118,126,883 D1081V probably benign Het
Dnah2 C A 11: 69,521,147 V263L probably benign Het
Efna3 C G 3: 89,315,498 R185P probably damaging Het
F5 A T 1: 164,211,820 I2000F probably damaging Het
Fancm G A 12: 65,094,871 G422E probably benign Het
Gcnt2 A T 13: 40,860,734 D127V probably damaging Het
Gm21798 G T 15: 64,817,769 probably benign Het
Gm340 T A 19: 41,584,162 V452D probably benign Het
Gramd1a A C 7: 31,138,867 S320R probably benign Het
Grn T C 11: 102,436,518 probably benign Het
Helq A T 5: 100,762,641 probably null Het
Herc2 A G 7: 56,177,912 I2914V probably benign Het
Hnrnph1 T C 11: 50,378,410 V27A probably damaging Het
Hs1bp3 G T 12: 8,324,007 G182C probably damaging Het
Idnk C T 13: 58,163,453 P78L probably benign Het
Il10ra T C 9: 45,255,621 D544G probably benign Het
Inpp5e T C 2: 26,400,906 D383G probably damaging Het
Jak1 A T 4: 101,179,714 V243D probably damaging Het
Kcnma1 A T 14: 23,309,152 S1036T probably damaging Het
Kif26a G A 12: 112,157,342 C127Y probably damaging Het
Kif2c T C 4: 117,166,411 E368G probably damaging Het
Lasp1 T A 11: 97,833,704 probably null Het
Lrrtm1 C G 6: 77,244,678 H373D probably benign Het
Matr3 T A 18: 35,572,701 D226E probably damaging Het
Mmp17 G A 5: 129,605,666 W456* probably null Het
Mpp4 T C 1: 59,125,589 E463G probably damaging Het
Myh6 A C 14: 54,956,962 F737V probably damaging Het
Nars2 T A 7: 97,023,741 D271E probably benign Het
Nav2 A G 7: 49,604,510 E2352G probably damaging Het
Nckap1 A G 2: 80,523,374 probably null Het
Nckap5 A T 1: 126,027,587 S477R probably damaging Het
Nek11 T G 9: 105,298,289 I319L probably benign Het
Neto2 A G 8: 85,669,764 I84T probably damaging Het
Nlrp9a A T 7: 26,550,944 I45F probably damaging Het
Numa1 G A 7: 102,012,805 R548H probably damaging Het
Olfr1154 A T 2: 87,903,189 N162K probably damaging Het
Olfr1186 T A 2: 88,525,910 I109N probably damaging Het
Olfr1258 A T 2: 89,930,579 M257L probably benign Het
Olfr1280 T A 2: 111,316,229 F250Y probably benign Het
Olfr292 A C 7: 86,695,187 I244L probably benign Het
Olfr694 A T 7: 106,689,533 L66H probably damaging Het
Olfr713 A C 7: 107,036,157 M1L probably benign Het
Olfr843 A G 9: 19,248,853 V182A probably benign Het
Pcdhb16 T A 18: 37,479,841 probably null Het
Pdcd10 T C 3: 75,541,246 T4A probably damaging Het
Pgc A T 17: 47,728,894 Y71F probably damaging Het
Phlpp1 G A 1: 106,389,751 G1234E probably damaging Het
Prr27 T C 5: 87,843,029 F167L probably benign Het
Prrc2b T A 2: 32,226,318 S1421T possibly damaging Het
Pxmp2 A G 5: 110,283,652 V75A probably benign Het
Pygl A T 12: 70,197,033 M545K probably null Het
Ranbp9 A G 13: 43,421,257 Y412H possibly damaging Het
Rcc1 A G 4: 132,337,753 V140A probably damaging Het
Reln A G 5: 21,979,720 V1599A probably benign Het
Rhebl1 A T 15: 98,879,022 D122E probably damaging Het
Rock2 C T 12: 16,959,491 L676F probably benign Het
Scn9a A T 2: 66,526,743 D1062E probably benign Het
Sec63 T C 10: 42,805,190 I390T probably damaging Het
Slc10a6 T C 5: 103,606,627 E346G probably benign Het
Slc12a3 G A 8: 94,348,588 V737M possibly damaging Het
Slc12a8 T C 16: 33,606,259 probably null Het
Slc25a38 T A 9: 120,120,288 I102N probably damaging Het
Spg7 T A 8: 123,080,655 V390E probably damaging Het
Tbc1d20 T C 2: 152,302,308 V75A probably benign Het
Tesk1 T A 4: 43,445,555 C243* probably null Het
Ttk T A 9: 83,843,686 N220K possibly damaging Het
Ttll5 A G 12: 85,919,174 E651G probably benign Het
Tubd1 T C 11: 86,567,053 Y426H probably damaging Het
Uba6 T C 5: 86,140,434 silent Het
Ube2ql1 G A 13: 69,704,170 R263W probably damaging Het
Vmn2r117 C T 17: 23,459,838 G804D probably damaging Het
Vmn2r25 C T 6: 123,828,447 E484K probably benign Het
Vmn2r4 T A 3: 64,389,055 I770F possibly damaging Het
Vmn2r82 G A 10: 79,378,755 V191M probably benign Het
Zbtb45 C T 7: 13,008,110 V74M probably damaging Het
Zfp366 T C 13: 99,234,101 V443A possibly damaging Het
Zfyve1 A T 12: 83,551,571 C628S probably damaging Het
Zfyve26 A T 12: 79,249,695 probably null Het
Other mutations in Chd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Chd9 APN 8 91025392 missense possibly damaging 0.79
IGL00547:Chd9 APN 8 91005798 missense probably damaging 1.00
IGL00589:Chd9 APN 8 91015846 missense probably damaging 1.00
IGL00640:Chd9 APN 8 90986132 missense probably damaging 0.99
IGL00663:Chd9 APN 8 90983490 missense probably damaging 1.00
IGL00852:Chd9 APN 8 90973207 missense probably benign 0.29
IGL00908:Chd9 APN 8 90996880 missense probably damaging 1.00
IGL00911:Chd9 APN 8 91051692 missense probably damaging 1.00
IGL01068:Chd9 APN 8 91042116 missense probably benign 0.13
IGL01668:Chd9 APN 8 91026776 missense possibly damaging 0.53
IGL01873:Chd9 APN 8 90933767 missense probably benign 0.00
IGL01969:Chd9 APN 8 91033510 missense possibly damaging 0.72
IGL02105:Chd9 APN 8 90932488 missense probably damaging 1.00
IGL02153:Chd9 APN 8 90956494 nonsense probably null
IGL02164:Chd9 APN 8 90933221 missense possibly damaging 0.94
IGL02725:Chd9 APN 8 91051684 missense possibly damaging 0.78
IGL02755:Chd9 APN 8 91033582 missense probably benign 0.33
IGL02892:Chd9 APN 8 90976915 splice site probably benign
IGL02897:Chd9 APN 8 90933868 splice site probably benign
IGL03005:Chd9 APN 8 91011447 missense probably damaging 0.98
IGL03062:Chd9 APN 8 91015267 splice site probably benign
IGL03140:Chd9 APN 8 91042228 missense possibly damaging 0.91
R0056:Chd9 UTSW 8 90933537 missense possibly damaging 0.62
R0157:Chd9 UTSW 8 91008836 splice site probably null
R0238:Chd9 UTSW 8 90932828 missense probably damaging 1.00
R0238:Chd9 UTSW 8 90932828 missense probably damaging 1.00
R0432:Chd9 UTSW 8 90994450 splice site probably benign
R0454:Chd9 UTSW 8 90973231 missense possibly damaging 0.83
R0573:Chd9 UTSW 8 90998595 missense probably damaging 1.00
R0580:Chd9 UTSW 8 90994563 missense possibly damaging 0.91
R0604:Chd9 UTSW 8 91036542 missense possibly damaging 0.82
R0662:Chd9 UTSW 8 90977676 missense probably damaging 0.99
R0825:Chd9 UTSW 8 91051197 missense probably benign 0.06
R0945:Chd9 UTSW 8 90933002 missense possibly damaging 0.60
R0964:Chd9 UTSW 8 91015204 missense probably benign 0.19
R0967:Chd9 UTSW 8 90989479 missense probably damaging 1.00
R1015:Chd9 UTSW 8 90932578 missense probably damaging 0.99
R1066:Chd9 UTSW 8 90986136 nonsense probably null
R1244:Chd9 UTSW 8 91022929 missense probably damaging 0.99
R1505:Chd9 UTSW 8 91006495 intron probably null
R1570:Chd9 UTSW 8 91036542 missense probably benign 0.03
R1591:Chd9 UTSW 8 90983538 missense probably damaging 0.97
R1624:Chd9 UTSW 8 90998535 missense probably benign 0.17
R1626:Chd9 UTSW 8 90994596 missense probably benign 0.00
R1632:Chd9 UTSW 8 90956707 nonsense probably null
R1649:Chd9 UTSW 8 90932601 missense possibly damaging 0.88
R1664:Chd9 UTSW 8 91022790 intron probably null
R1668:Chd9 UTSW 8 91041186 missense probably damaging 0.99
R1681:Chd9 UTSW 8 90973135 missense probably damaging 0.98
R1695:Chd9 UTSW 8 91001782 missense probably damaging 1.00
R1714:Chd9 UTSW 8 91034225 utr 3 prime probably benign
R1746:Chd9 UTSW 8 91010698 missense probably benign 0.01
R1843:Chd9 UTSW 8 91010794 missense probably benign 0.19
R1844:Chd9 UTSW 8 90956695 nonsense probably null
R1941:Chd9 UTSW 8 90977069 critical splice donor site probably null
R2022:Chd9 UTSW 8 91035054 missense probably benign 0.17
R2027:Chd9 UTSW 8 90907991 unclassified probably benign
R2098:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2099:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2100:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2101:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2224:Chd9 UTSW 8 91011285 missense probably benign 0.04
R2276:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2278:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2316:Chd9 UTSW 8 91051128 missense probably damaging 0.99
R2507:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2508:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2988:Chd9 UTSW 8 91030460 intron probably null
R3418:Chd9 UTSW 8 91036591 missense probably damaging 1.00
R3817:Chd9 UTSW 8 90984265 splice site probably benign
R3923:Chd9 UTSW 8 90933519 missense probably benign 0.16
R4001:Chd9 UTSW 8 90956557 missense probably damaging 1.00
R4003:Chd9 UTSW 8 90956557 missense probably damaging 1.00
R4006:Chd9 UTSW 8 90933560 missense probably benign 0.12
R4013:Chd9 UTSW 8 90973169 missense possibly damaging 0.82
R4067:Chd9 UTSW 8 91023574 missense possibly damaging 0.53
R4108:Chd9 UTSW 8 91010676 missense probably benign 0.04
R4125:Chd9 UTSW 8 91051284 missense probably damaging 0.99
R4126:Chd9 UTSW 8 91051284 missense probably damaging 0.99
R4452:Chd9 UTSW 8 90977680 missense probably damaging 0.99
R4463:Chd9 UTSW 8 90978999 missense probably benign 0.01
R4478:Chd9 UTSW 8 91034031 utr 3 prime probably benign
R4587:Chd9 UTSW 8 91036506 missense possibly damaging 0.95
R4628:Chd9 UTSW 8 90983463 missense probably benign 0.05
R4667:Chd9 UTSW 8 91033800 missense possibly damaging 0.73
R4912:Chd9 UTSW 8 91034230 missense possibly damaging 0.84
R4977:Chd9 UTSW 8 91033708 missense possibly damaging 0.96
R5016:Chd9 UTSW 8 91006626 nonsense probably null
R5083:Chd9 UTSW 8 90984374 missense probably damaging 1.00
R5088:Chd9 UTSW 8 90977519 missense possibly damaging 0.94
R5090:Chd9 UTSW 8 91026834 nonsense probably null
R5307:Chd9 UTSW 8 90997149 missense probably damaging 1.00
R5541:Chd9 UTSW 8 91051504 missense probably benign 0.09
R5559:Chd9 UTSW 8 91015925 critical splice donor site probably null
R5638:Chd9 UTSW 8 91011450 missense possibly damaging 0.67
R5640:Chd9 UTSW 8 91036562 missense probably damaging 1.00
R5793:Chd9 UTSW 8 91001756 missense probably damaging 1.00
R5827:Chd9 UTSW 8 90989450 missense probably damaging 1.00
R5834:Chd9 UTSW 8 90997164 missense probably damaging 1.00
R5875:Chd9 UTSW 8 91051836 missense probably damaging 0.99
R6002:Chd9 UTSW 8 90978887 missense probably damaging 1.00
R6091:Chd9 UTSW 8 91035063 missense probably damaging 1.00
R6185:Chd9 UTSW 8 91049137 missense probably damaging 1.00
R6246:Chd9 UTSW 8 90932417 missense probably damaging 1.00
R6292:Chd9 UTSW 8 90932922 missense probably benign 0.05
R6305:Chd9 UTSW 8 91030546 missense possibly damaging 0.93
R6348:Chd9 UTSW 8 91011275 missense possibly damaging 0.95
R6438:Chd9 UTSW 8 90998521 missense probably benign 0.02
R6470:Chd9 UTSW 8 90932798 missense probably damaging 1.00
R6798:Chd9 UTSW 8 91051554 missense possibly damaging 0.56
R6902:Chd9 UTSW 8 91042951 missense probably damaging 1.00
R6908:Chd9 UTSW 8 90956416 missense probably benign 0.02
R6929:Chd9 UTSW 8 91042945 missense probably damaging 1.00
R6969:Chd9 UTSW 8 90978914 missense probably benign 0.34
X0065:Chd9 UTSW 8 91036572 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCAACCTTCTGCATTCG -3'
(R):5'- CCAGGAAGGGACAAGTTTATCTGG -3'

Sequencing Primer
(F):5'- GCAACCTTCTGCATTCGAAACATC -3'
(R):5'- TGTGCTCTCACTAGACTC -3'
Posted On2016-04-15