Incidental Mutation 'R4909:Prom1'
ID379275
Institutional Source Beutler Lab
Gene Symbol Prom1
Ensembl Gene ENSMUSG00000029086
Gene Nameprominin 1
Synonyms4932416E19Rik, Prom, AC133, CD133, Prom-1
MMRRC Submission 042511-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.447) question?
Stock #R4909 (G1)
Quality Score218
Status Validated
Chromosome5
Chromosomal Location43993620-44102032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44045552 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 213 (N213S)
Ref Sequence ENSEMBL: ENSMUSP00000142375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030973] [ENSMUST00000074113] [ENSMUST00000087441] [ENSMUST00000087442] [ENSMUST00000165909] [ENSMUST00000171543] [ENSMUST00000177946] [ENSMUST00000179059] [ENSMUST00000197706] [ENSMUST00000197750]
Predicted Effect probably benign
Transcript: ENSMUST00000030973
AA Change: N213S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000030973
Gene: ENSMUSG00000029086
AA Change: N213S

DomainStartEndE-ValueType
Pfam:Prominin 11 326 1.5e-113 PFAM
Pfam:Prominin 322 798 4.6e-188 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074113
AA Change: N222S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000073751
Gene: ENSMUSG00000029086
AA Change: N222S

DomainStartEndE-ValueType
low complexity region 8 13 N/A INTRINSIC
Pfam:Prominin 18 822 2e-294 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087441
AA Change: N213S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000084707
Gene: ENSMUSG00000029086
AA Change: N213S

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087442
AA Change: N213S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000084709
Gene: ENSMUSG00000029086
AA Change: N213S

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165909
AA Change: N213S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000129909
Gene: ENSMUSG00000029086
AA Change: N213S

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171543
AA Change: N222S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000128978
Gene: ENSMUSG00000029086
AA Change: N222S

DomainStartEndE-ValueType
Pfam:Prominin 11 838 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177946
AA Change: N213S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000136483
Gene: ENSMUSG00000029086
AA Change: N213S

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179059
AA Change: N222S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000137557
Gene: ENSMUSG00000029086
AA Change: N222S

DomainStartEndE-ValueType
Pfam:Prominin 11 838 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196852
Predicted Effect probably benign
Transcript: ENSMUST00000197706
AA Change: N208S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000142632
Gene: ENSMUSG00000029086
AA Change: N208S

DomainStartEndE-ValueType
Pfam:Prominin 11 321 6.6e-110 PFAM
Pfam:Prominin 317 793 6.8e-188 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197749
Predicted Effect probably benign
Transcript: ENSMUST00000197750
AA Change: N213S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000142375
Gene: ENSMUSG00000029086
AA Change: N213S

DomainStartEndE-ValueType
Pfam:Prominin 11 823 N/A PFAM
Predicted Effect unknown
Transcript: ENSMUST00000198347
AA Change: N7S
Meta Mutation Damage Score 0.1252 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 97% (101/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pentaspan transmembrane glycoprotein. The protein localizes to membrane protrusions and is often expressed on adult stem cells, where it is thought to function in maintaining stem cell properties by suppressing differentiation. Mutations in this gene have been shown to result in retinitis pigmentosa and Stargardt disease. Expression of this gene is also associated with several types of cancer. This gene is expressed from at least five alternative promoters that are expressed in a tissue-dependent manner. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal retina morphology, vasculature, and electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030C10Rik A T 12: 20,815,088 noncoding transcript Het
A830010M20Rik C T 5: 107,507,310 Q992* probably null Het
Aars G A 8: 111,055,083 G929D probably damaging Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Actn4 A T 7: 28,898,657 L506Q probably damaging Het
Adam26a A T 8: 43,570,438 F5Y probably benign Het
Adamts5 G A 16: 85,900,066 Q68* probably null Het
Adcy9 A G 16: 4,298,754 I871T probably benign Het
Ak5 A T 3: 152,655,877 L136H probably damaging Het
Ap1g2 A G 14: 55,105,026 probably null Het
Ap2a1 G A 7: 44,906,381 T355M probably damaging Het
Ap3s2 T C 7: 79,915,241 D60G possibly damaging Het
Apold1 G A 6: 134,983,595 R4Q probably benign Het
Atp13a5 G T 16: 29,334,028 Q207K possibly damaging Het
BC035947 A C 1: 78,498,029 I622S probably damaging Het
Bmper G T 9: 23,377,725 V339F probably benign Het
C1ra A G 6: 124,522,334 D493G probably damaging Het
C3 C T 17: 57,226,830 probably null Het
Cabp4 T A 19: 4,137,121 I209F possibly damaging Het
Cacna1s A T 1: 136,079,604 H453L probably damaging Het
Camk2g A G 14: 20,792,584 V32A probably benign Het
Ccdc175 G A 12: 72,159,753 R240C probably damaging Het
Cdk13 C T 13: 17,772,403 S590N possibly damaging Het
Cfap45 A T 1: 172,529,876 T24S probably benign Het
Clca1 T G 3: 145,024,563 K174Q probably damaging Het
Col1a2 G A 6: 4,529,058 probably benign Het
Colgalt1 A T 8: 71,620,633 I323F possibly damaging Het
Cpeb3 T C 19: 37,174,233 S248G possibly damaging Het
Cpeb3 A T 19: 37,174,659 S106T probably damaging Het
Ctcfl C T 2: 173,095,398 A576T probably benign Het
Cyp4f16 T G 17: 32,550,321 V395G possibly damaging Het
Dchs1 C T 7: 105,766,255 G605S probably damaging Het
Egflam A T 15: 7,219,629 F903I probably damaging Het
Eif5a G A 11: 69,917,485 A62V possibly damaging Het
Fam217a A G 13: 34,910,406 S609P probably damaging Het
Fhad1 T A 4: 141,985,511 I206F probably benign Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fras1 T A 5: 96,708,758 M2000K probably benign Het
Frmd5 C T 2: 121,591,653 probably null Het
Gle1 T C 2: 29,936,080 L57P probably benign Het
Glrx3 C A 7: 137,445,036 N52K probably damaging Het
Grin3b A G 10: 79,977,104 *1004W probably null Het
Hectd4 T A 5: 121,263,891 F347L probably benign Het
Htra1 G A 7: 130,985,072 V462I probably benign Het
Itga11 A G 9: 62,755,299 Y518C probably damaging Het
Krtap15 T C 16: 88,829,365 F88L probably benign Het
Ktn1 A T 14: 47,706,460 R866W probably damaging Het
Lamb1 G A 12: 31,288,281 R483H probably damaging Het
Megf6 C T 4: 154,265,391 R983C probably damaging Het
Mybpc3 T A 2: 91,134,812 D1075E probably benign Het
Myo7b A T 18: 31,964,436 N1792K probably benign Het
Nabp2 A T 10: 128,401,687 probably benign Het
Neil3 A G 8: 53,638,893 C7R probably damaging Het
Nxpe2 T A 9: 48,319,597 I491F possibly damaging Het
Obscn A G 11: 59,061,465 V4292A possibly damaging Het
Ogfod3 A G 11: 121,197,492 S139P probably damaging Het
Olfr374 A G 8: 72,109,581 N5S probably damaging Het
Olfr418 A T 1: 173,270,979 D268V probably damaging Het
Olfr682-ps1 C A 7: 105,128,228 V70L probably benign Het
Olfr800 A G 10: 129,660,720 I305V probably benign Het
Oog2 T C 4: 144,195,099 I211T possibly damaging Het
Oosp1 T C 19: 11,688,716 D70G probably benign Het
Padi3 T C 4: 140,795,626 D345G probably damaging Het
Pcyt2 A G 11: 120,615,420 F71L probably benign Het
Pi4k2b T C 5: 52,754,629 probably benign Het
Pigr A C 1: 130,848,458 T577P possibly damaging Het
Pirb G A 7: 3,719,362 Q161* probably null Het
Pnlip A G 19: 58,676,240 E204G possibly damaging Het
Pop7 G T 5: 137,501,899 D57E probably benign Het
Ppfia4 A T 1: 134,332,501 I8N probably damaging Het
Pprc1 A G 19: 46,064,319 T759A probably damaging Het
Prop1 GCTTCACT GCTTCACTTCACT 11: 50,952,036 probably null Het
Prop1 A T 11: 50,952,045 L105H probably damaging Het
Pwp2 A T 10: 78,182,494 M121K possibly damaging Het
Rap1gds1 A T 3: 138,983,748 M161K possibly damaging Het
Rps6kb2 T A 19: 4,157,003 probably benign Het
Rxfp1 A G 3: 79,644,802 S731P probably benign Het
Scfd1 T C 12: 51,390,412 V137A probably benign Het
Slc6a15 G A 10: 103,404,414 D333N probably damaging Het
Sqor T C 2: 122,785,181 V74A possibly damaging Het
Stil T A 4: 115,024,225 Y655* probably null Het
Syt14 A T 1: 192,898,859 I468K probably damaging Het
Tbc1d31 T C 15: 57,962,265 probably null Het
Tspyl5 A T 15: 33,686,849 S317T probably damaging Het
Ttf1 C T 2: 29,064,656 H11Y possibly damaging Het
Ttf2 T C 3: 100,954,315 T620A probably damaging Het
Usp32 G A 11: 85,055,772 Q269* probably null Het
Vsig10 T A 5: 117,338,243 V254E probably benign Het
Wdr6 C T 9: 108,572,988 A1114T probably benign Het
Zfp280d A G 9: 72,331,432 S63G probably damaging Het
Zfp607b A G 7: 27,703,796 D559G probably benign Het
Zfp934 T C 13: 62,517,954 H291R probably damaging Het
Other mutations in Prom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Prom1 APN 5 44055937 missense probably damaging 1.00
IGL00392:Prom1 APN 5 44007021 critical splice donor site probably null
IGL00771:Prom1 APN 5 44029776 splice site probably benign
IGL00841:Prom1 APN 5 44063116 splice site probably benign
IGL01780:Prom1 APN 5 44029604 splice site probably benign
IGL01991:Prom1 APN 5 44047506 missense probably benign 0.13
IGL02220:Prom1 APN 5 44014789 missense probably damaging 1.00
IGL02350:Prom1 APN 5 44029604 splice site probably benign
IGL02357:Prom1 APN 5 44029604 splice site probably benign
IGL02420:Prom1 APN 5 44063154 missense probably benign 0.15
IGL02468:Prom1 APN 5 44029698 missense probably benign 0.01
IGL02633:Prom1 APN 5 44014775 missense probably benign 0.20
IGL02871:Prom1 APN 5 44029676 missense probably damaging 1.00
IGL02967:Prom1 APN 5 44044398 missense probably damaging 1.00
IGL03033:Prom1 APN 5 44006160 splice site probably null
IGL03072:Prom1 APN 5 44058662 intron probably benign
IGL03149:Prom1 APN 5 44029734 missense probably damaging 0.99
IGL03277:Prom1 APN 5 44032971 nonsense probably null
R1018:Prom1 UTSW 5 44029714 missense probably benign 0.02
R1456:Prom1 UTSW 5 44037623 missense probably damaging 0.96
R1458:Prom1 UTSW 5 44032932 splice site probably benign
R1536:Prom1 UTSW 5 44018353 missense probably benign 0.39
R1747:Prom1 UTSW 5 44007031 missense probably benign 0.03
R1772:Prom1 UTSW 5 44011224 missense probably benign 0.00
R2020:Prom1 UTSW 5 44011253 splice site probably benign
R2022:Prom1 UTSW 5 44029726 missense probably benign 0.18
R2091:Prom1 UTSW 5 44014086 splice site probably benign
R2163:Prom1 UTSW 5 44014163 missense possibly damaging 0.72
R2177:Prom1 UTSW 5 44026739 missense possibly damaging 0.67
R3015:Prom1 UTSW 5 44034391 missense probably damaging 1.00
R3022:Prom1 UTSW 5 44047574 missense probably damaging 1.00
R4824:Prom1 UTSW 5 44034390 missense probably damaging 0.98
R4999:Prom1 UTSW 5 44037534 missense probably benign 0.00
R5082:Prom1 UTSW 5 44000832 unclassified probably null
R5351:Prom1 UTSW 5 44044355 missense probably damaging 1.00
R5401:Prom1 UTSW 5 44000805 missense probably damaging 0.99
R5440:Prom1 UTSW 5 44058646 missense probably benign
R5529:Prom1 UTSW 5 44026768 missense probably damaging 1.00
R5537:Prom1 UTSW 5 44000776 critical splice donor site probably null
R5669:Prom1 UTSW 5 44012943 missense possibly damaging 0.64
R5723:Prom1 UTSW 5 44014894 missense probably benign 0.30
R5778:Prom1 UTSW 5 44007047 missense probably benign 0.13
R5924:Prom1 UTSW 5 44004963 missense probably benign 0.02
R6034:Prom1 UTSW 5 44044408 critical splice acceptor site probably null
R6034:Prom1 UTSW 5 44044408 critical splice acceptor site probably null
R6038:Prom1 UTSW 5 44001793 missense probably damaging 1.00
R6038:Prom1 UTSW 5 44001793 missense probably damaging 1.00
R6145:Prom1 UTSW 5 44029649 missense probably benign 0.05
R6374:Prom1 UTSW 5 44055983 missense probably damaging 1.00
R6542:Prom1 UTSW 5 44037509 missense possibly damaging 0.84
R6645:Prom1 UTSW 5 44047514 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGAACCATCCAATGTCCAGTG -3'
(R):5'- CGGTAAAACGTGGGAGTACC -3'

Sequencing Primer
(F):5'- TGGTAAACACACAGTAGTTCTACAGC -3'
(R):5'- GAGTACCAGATGAGCGTTCACC -3'
Posted On2016-04-15